Incidental Mutation 'R0121:Mamdc2'
ID21064
Institutional Source Beutler Lab
Gene Symbol Mamdc2
Ensembl Gene ENSMUSG00000033207
Gene NameMAM domain containing 2
Synonyms1200015L10Rik, mamcan
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0121 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location23302609-23448322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23310859 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 605 (E605V)
Ref Sequence ENSEMBL: ENSMUSP00000045432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036069]
Predicted Effect probably benign
Transcript: ENSMUST00000036069
AA Change: E605V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045432
Gene: ENSMUSG00000033207
AA Change: E605V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 21 169 3.15e-12 SMART
MAM 170 329 9.26e-42 SMART
MAM 337 498 1.07e-32 SMART
MAM 504 666 3.55e-61 SMART
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Grhl3 A G 4: 135,552,549 I398T probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Mamdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mamdc2 APN 19 23378774 nonsense probably null
IGL00588:Mamdc2 APN 19 23353316 missense possibly damaging 0.89
IGL01105:Mamdc2 APN 19 23331002 missense probably benign 0.36
IGL02223:Mamdc2 APN 19 23359143 splice site probably benign
IGL02511:Mamdc2 APN 19 23378731 missense probably benign 0.00
IGL02632:Mamdc2 APN 19 23330976 missense probably benign 0.03
IGL02832:Mamdc2 APN 19 23303851 missense probably damaging 0.99
R0071:Mamdc2 UTSW 19 23303630 nonsense probably null
R0732:Mamdc2 UTSW 19 23378869 missense probably damaging 0.98
R1023:Mamdc2 UTSW 19 23310907 missense probably damaging 1.00
R1860:Mamdc2 UTSW 19 23359153 missense probably damaging 0.98
R1861:Mamdc2 UTSW 19 23359153 missense probably damaging 0.98
R1996:Mamdc2 UTSW 19 23363925 nonsense probably null
R2012:Mamdc2 UTSW 19 23310851 missense probably benign 0.00
R2016:Mamdc2 UTSW 19 23334029 missense probably damaging 0.98
R2266:Mamdc2 UTSW 19 23303903 splice site probably benign
R2267:Mamdc2 UTSW 19 23303903 splice site probably benign
R2269:Mamdc2 UTSW 19 23303903 splice site probably benign
R3085:Mamdc2 UTSW 19 23310932 missense possibly damaging 0.80
R4235:Mamdc2 UTSW 19 23374017 missense possibly damaging 0.94
R4672:Mamdc2 UTSW 19 23350784 missense probably damaging 1.00
R5074:Mamdc2 UTSW 19 23378796 missense probably benign 0.01
R5084:Mamdc2 UTSW 19 23359152 missense possibly damaging 0.95
R5521:Mamdc2 UTSW 19 23310938 missense probably damaging 1.00
R6119:Mamdc2 UTSW 19 23353315 missense probably damaging 1.00
R6334:Mamdc2 UTSW 19 23363906 missense probably damaging 1.00
R6557:Mamdc2 UTSW 19 23310845 missense possibly damaging 0.80
R6676:Mamdc2 UTSW 19 23303633 missense probably damaging 1.00
R7218:Mamdc2 UTSW 19 23447610 missense probably benign 0.00
R7616:Mamdc2 UTSW 19 23350804 missense probably damaging 1.00
R7627:Mamdc2 UTSW 19 23310991 missense probably damaging 0.99
R8101:Mamdc2 UTSW 19 23334029 missense probably damaging 0.98
Z1176:Mamdc2 UTSW 19 23334057 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGTCCAAAGCGTTAGCTTCCTGTC -3'
(R):5'- TCGAAGCCTCCCACATGGTGTATG -3'

Sequencing Primer
(F):5'- CAATTATCCGTTCACTGCTTAGAG -3'
(R):5'- TCCCACATGGTGTATGGACAG -3'
Posted On2013-04-11