Mutagenetix > Incidental Mutations

Incidental Mutation 'R1870:Dlgap2'

210650

Institutional Source

Beutler Lab

Gene Symbol

Dlgap2

Ensembl Gene

ENSMUSG00000047495

Gene Name

DLG associated protein 2

Synonyms

PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2

MMRRC Submission

039892-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14095865-14847680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14773347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 522 (V522E)

Ref Sequence

ENSEMBL: ENSMUSP00000123104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]

AlphaFold

Q8BJ42

Predicted Effect

probably damaging
Transcript: ENSMUST00000043279
AA Change: V522E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: V522E

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1059	1.5e-151	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129119

Predicted Effect

probably damaging
Transcript: ENSMUST00000133298
AA Change: V522E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: V522E

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1059	1.5e-151	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141214

Predicted Effect

probably damaging
Transcript: ENSMUST00000150247
AA Change: V522E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: V522E

Domain	Start	End	E-Value	Type
low complexity region	269	294	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	446	456	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
Pfam:GKAP	707	1045	1e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152652
AA Change: V523E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: V523E

Domain	Start	End	E-Value	Type
low complexity region	270	295	N/A	INTRINSIC
low complexity region	298	311	N/A	INTRINSIC
low complexity region	447	457	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	615	629	N/A	INTRINSIC
Pfam:GKAP	715	1060	1.9e-160	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.1%
20x: 92.1%

Validation Efficiency

97% (96/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	G	5: 9,418,007	E225G	probably damaging	Het
Abca13	A	T	11: 9,292,134	E1332D	probably benign	Het
Abca5	C	A	11: 110,329,217	V8L	probably benign	Het
Abcc8	C	T	7: 46,123,915	E797K	probably benign	Het
Acd	C	A	8: 105,698,407		probably null	Het
Adamts12	T	C	15: 11,311,154	S1166P	probably benign	Het
AI481877	G	A	4: 59,054,142		probably benign	Het
Alox12b	T	C	11: 69,158,373	Y83H	possibly damaging	Het
Antxr2	A	T	5: 98,030,438	S38T	probably damaging	Het
Aox1	A	G	1: 58,076,103	E749G	probably damaging	Het
Arpc1a	T	A	5: 145,107,091	C344S	possibly damaging	Het
BC055324	G	A	1: 163,964,794	L545F	probably damaging	Het
Bcan	T	C	3: 87,995,601	Y290C	probably damaging	Het
Bod1l	G	A	5: 41,833,675	S179F	possibly damaging	Het
Catsper3	A	C	13: 55,805,748	D224A	probably damaging	Het
Ccar2	A	G	14: 70,140,497	S680P	probably damaging	Het
Ccdc18	A	G	5: 108,220,837	H1275R	possibly damaging	Het
Ccdc40	T	C	11: 119,259,904	M1011T	possibly damaging	Het
Cfap46	T	A	7: 139,683,470	D17V	probably damaging	Het
Csn1s2a	T	C	5: 87,778,199	F45L	probably benign	Het
Cwf19l2	T	G	9: 3,458,802	N750K	possibly damaging	Het
Cyb5r4	A	G	9: 87,040,409	D157G	probably benign	Het
D130040H23Rik	T	A	8: 69,302,702	I253N	probably benign	Het
Dennd4a	C	T	9: 64,897,234	A1285V	probably benign	Het
Dlat	A	G	9: 50,637,574	S561P	probably damaging	Het
Dnah5	T	A	15: 28,331,713	Y2148*	probably null	Het
Dnase2a	T	C	8: 84,908,763		probably benign	Het
Fam83f	T	C	15: 80,689,912		probably benign	Het
Foxi1	A	T	11: 34,207,937	N29K	possibly damaging	Het
Galk2	T	C	2: 125,975,263	L324P	probably benign	Het
Gdpd4	G	A	7: 97,972,955	V214I	probably benign	Het
Gfra3	C	T	18: 34,711,320	A56T	probably damaging	Het
Glyctk	A	G	9: 106,155,348	S489P	probably damaging	Het
Gm5346	A	T	8: 43,625,095	Y697*	probably null	Het
Gm884	T	C	11: 103,620,605	D179G	unknown	Het
Izumo4	A	T	10: 80,703,735	I135F	probably damaging	Het
Krt83	T	A	15: 101,487,190	T342S	probably benign	Het
L1td1	T	A	4: 98,737,477	D636E	possibly damaging	Het
Letm2	A	G	8: 25,596,444		probably benign	Het
Lpin1	A	G	12: 16,541,743	F828L	probably damaging	Het
Mdn1	T	A	4: 32,763,339	D5146E	probably damaging	Het
Megf10	T	A	18: 57,191,185	Y99*	probably null	Het
Men1	A	G	19: 6,337,630	D285G	probably damaging	Het
Mertk	T	G	2: 128,801,196	D838E	probably benign	Het
Mta1	T	C	12: 113,128,074	S266P	possibly damaging	Het
Mta3	G	A	17: 83,781,968	V320M	probably damaging	Het
Nlrp9c	G	A	7: 26,384,820	Q445*	probably null	Het
Olfr164	A	T	16: 19,286,607	N45K	probably damaging	Het
Olfr558	T	C	7: 102,709,754	I165T	possibly damaging	Het
Olfr885	A	T	9: 38,061,350	K10I	probably benign	Het
Olfr974	T	G	9: 39,942,821	I187R	probably damaging	Het
Pbrm1	T	A	14: 31,106,175	L1320I	probably damaging	Het
Pdzd2	G	T	15: 12,457,886	T297K	probably damaging	Het
Pfas	T	C	11: 68,991,969	D782G	probably damaging	Het
Pik3c3	T	C	18: 30,293,132		probably null	Het
Pira2	T	C	7: 3,844,453	N79S	probably damaging	Het
Pkdrej	G	T	15: 85,816,431	T1768K	probably damaging	Het
Plcb3	T	C	19: 6,962,985	I439V	probably benign	Het
Pold4	T	A	19: 4,232,539	Y58*	probably null	Het
Ppef2	T	G	5: 92,250,512	Q49P	probably damaging	Het
Ralgapa1	T	A	12: 55,677,032	I2026F	possibly damaging	Het
Rest	T	A	5: 77,268,362	V141E	possibly damaging	Het
Rnf139	T	C	15: 58,899,353	V409A	probably benign	Het
Rnpc3	T	C	3: 113,611,055		probably benign	Het
S100a10	A	T	3: 93,561,070	E36V	probably benign	Het
S1pr3	A	C	13: 51,419,916	K378Q	probably benign	Het
Scaper	T	A	9: 55,685,938	I472F	probably damaging	Het
Sgcg	G	A	14: 61,240,447		probably benign	Het
Shank1	A	T	7: 44,342,115	R69*	probably null	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Slc25a54	T	A	3: 109,080,616	Y24*	probably null	Het
Slc29a4	T	C	5: 142,721,488	*529R	probably null	Het
Slc41a2	G	A	10: 83,301,165	Q293*	probably null	Het
Slc4a7	T	C	14: 14,737,509		probably null	Het
Slfn9	G	T	11: 82,981,576	T778N	probably benign	Het
Ssr2	T	C	3: 88,576,642		probably benign	Het
Tecrl	T	A	5: 83,354,859	T33S	probably benign	Het
Tnfrsf9	T	A	4: 150,934,347	C158*	probably null	Het
Tradd	T	C	8: 105,259,160	E253G	possibly damaging	Het
Usp34	A	G	11: 23,364,479	H807R	probably benign	Het
Vmn2r27	T	C	6: 124,224,211	I262M	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps13a	A	G	19: 16,759,952	V91A	probably damaging	Het
Vwf	C	T	6: 125,642,939	R1527C	probably damaging	Het
Wwc1	C	T	11: 35,861,945	G763D	probably damaging	Het
Zfp526	T	G	7: 25,225,169	D284E	possibly damaging	Het
Zfp646	T	C	7: 127,883,849	F1733L	possibly damaging	Het
Zfp90	A	G	8: 106,419,123	H29R	probably benign	Het
Zkscan4	A	G	13: 21,483,934	E185G	probably benign	Het

Other mutations in Dlgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01476:Dlgap2	APN	8	14778301	nonsense	probably null
IGL01788:Dlgap2	APN	8	14843631	missense	probably benign	0.19
IGL02054:Dlgap2	APN	8	14843552	missense	probably damaging	0.98
IGL02969:Dlgap2	APN	8	14831579	missense	possibly damaging	0.95
IGL03183:Dlgap2	APN	8	14727525	missense	possibly damaging	0.62
IGL03303:Dlgap2	APN	8	14727812	missense	probably damaging	0.99
G1Funyon:Dlgap2	UTSW	8	14823577	missense	probably benign	0.27
PIT4403001:Dlgap2	UTSW	8	14831528	missense	probably damaging	1.00
R0026:Dlgap2	UTSW	8	14727363	nonsense	probably null
R0242:Dlgap2	UTSW	8	14727562	missense	probably benign	0.34
R0242:Dlgap2	UTSW	8	14727562	missense	probably benign	0.34
R0647:Dlgap2	UTSW	8	14727591	missense	possibly damaging	0.95
R1221:Dlgap2	UTSW	8	14726952	missense	probably benign	0.08
R1374:Dlgap2	UTSW	8	14831228	splice site	probably benign
R1440:Dlgap2	UTSW	8	14727060	missense	probably benign
R1544:Dlgap2	UTSW	8	14829861	splice site	probably null
R1550:Dlgap2	UTSW	8	14822499	missense	probably damaging	0.98
R1804:Dlgap2	UTSW	8	14727809	missense	possibly damaging	0.71
R1921:Dlgap2	UTSW	8	14843624	missense	probably benign	0.10
R2119:Dlgap2	UTSW	8	14778206	missense	possibly damaging	0.69
R2193:Dlgap2	UTSW	8	14743431	missense	possibly damaging	0.51
R4381:Dlgap2	UTSW	8	14846502	missense	probably benign
R4422:Dlgap2	UTSW	8	14743463	critical splice donor site	probably null
R4521:Dlgap2	UTSW	8	14727871	missense	probably damaging	1.00
R4581:Dlgap2	UTSW	8	14846679	missense	probably damaging	1.00
R4585:Dlgap2	UTSW	8	14727999	critical splice donor site	probably null
R4760:Dlgap2	UTSW	8	14773380	missense	probably damaging	1.00
R5077:Dlgap2	UTSW	8	14822691	missense	probably benign	0.35
R5373:Dlgap2	UTSW	8	14823614	missense	probably benign	0.19
R5374:Dlgap2	UTSW	8	14823614	missense	probably benign	0.19
R5552:Dlgap2	UTSW	8	14831342	nonsense	probably null
R5964:Dlgap2	UTSW	8	14727128	nonsense	probably null
R6125:Dlgap2	UTSW	8	14727193	missense	possibly damaging	0.78
R6147:Dlgap2	UTSW	8	14727294	missense	probably benign	0.05
R6163:Dlgap2	UTSW	8	14846641	missense	probably damaging	1.00
R6269:Dlgap2	UTSW	8	14822369	missense	probably benign	0.01
R6629:Dlgap2	UTSW	8	14831465	missense	probably benign	0.00
R6765:Dlgap2	UTSW	8	14743284	missense	probably benign	0.00
R6809:Dlgap2	UTSW	8	14179619	intron	probably benign
R6913:Dlgap2	UTSW	8	14778374	missense	probably benign	0.10
R7219:Dlgap2	UTSW	8	14743296	missense	probably benign	0.00
R7485:Dlgap2	UTSW	8	14829952	missense	probably damaging	0.97
R7560:Dlgap2	UTSW	8	14822697	critical splice donor site	probably null
R7826:Dlgap2	UTSW	8	14743410	missense	probably benign	0.38
R7976:Dlgap2	UTSW	8	14743410	missense	probably benign	0.38
R8101:Dlgap2	UTSW	8	14831600	missense	probably benign	0.04
R8301:Dlgap2	UTSW	8	14823577	missense	probably benign	0.27
R8333:Dlgap2	UTSW	8	14778295	missense	probably benign	0.03
R8367:Dlgap2	UTSW	8	14843544	missense	probably benign	0.00
R8492:Dlgap2	UTSW	8	14778271	missense	possibly damaging	0.49
R8685:Dlgap2	UTSW	8	14831628	missense	possibly damaging	0.71
R8690:Dlgap2	UTSW	8	14743430	missense	probably benign	0.00
R8887:Dlgap2	UTSW	8	14179682	critical splice donor site	probably null
R9328:Dlgap2	UTSW	8	14727441	missense	probably damaging	1.00
R9338:Dlgap2	UTSW	8	14179683	critical splice donor site	probably null
R9465:Dlgap2	UTSW	8	14778226	missense	probably damaging	1.00
X0060:Dlgap2	UTSW	8	14839787	missense	probably damaging	1.00
Z1088:Dlgap2	UTSW	8	14822472	missense	probably benign	0.10
Z1177:Dlgap2	UTSW	8	14727659	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATCTACTGGCAGCCATCTCC -3'
(R):5'- GCCTAAGCCGATGAGGTTTTG -3'

Sequencing Primer
(F):5'- GGCAGCCATCTCCTCCTAC -3'
(R):5'- CGCTAAATCAAGACAGACTGTTGTG -3'

Posted On

2014-06-30