Incidental Mutation 'R1870:Dnase2a'
ID210653
Institutional Source Beutler Lab
Gene Symbol Dnase2a
Ensembl Gene ENSMUSG00000003812
Gene Namedeoxyribonuclease II alpha
Synonyms
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1870 (G1)
Quality Score174
Status Validated
Chromosome8
Chromosomal Location84908560-84922915 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 84908763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000067060] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
Predicted Effect probably benign
Transcript: ENSMUST00000003910
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067060
SMART Domains Protein: ENSMUSP00000064366
Gene: ENSMUSG00000054191

DomainStartEndE-ValueType
Pfam:EKLF_TAD1 40 66 9e-23 PFAM
Pfam:EKLF_TAD2 78 103 4.9e-16 PFAM
low complexity region 153 180 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 293 317 2.2e-2 SMART
ZnF_C2H2 323 347 7.49e-5 SMART
ZnF_C2H2 353 375 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109741
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109744
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect probably benign
Transcript: ENSMUST00000134569
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect probably benign
Transcript: ENSMUST00000145292
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155942
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2*L (low activity) and DNASE2*H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutations of this gene result in perinatal death, anemia, and impaired definitive erythropoiesis in the fetal liver. Homozygotes for one null mutation display diaphragm abnormalities and asphyxiation, as well as a specific defect in the phagocytic phase of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Galk2 T C 2: 125,975,263 L324P probably benign Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lpin1 A G 12: 16,541,743 F828L probably damaging Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Men1 A G 19: 6,337,630 D285G probably damaging Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr164 A T 16: 19,286,607 N45K probably damaging Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tnfrsf9 T A 4: 150,934,347 C158* probably null Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Dnase2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0396:Dnase2a UTSW 8 84909763 splice site probably benign
R1845:Dnase2a UTSW 8 84909322 missense probably benign 0.19
R1939:Dnase2a UTSW 8 84910895 missense possibly damaging 0.83
R2113:Dnase2a UTSW 8 84910871 missense probably damaging 0.99
R2442:Dnase2a UTSW 8 84908993 missense probably damaging 1.00
R4815:Dnase2a UTSW 8 84909877 missense probably benign 0.12
R4913:Dnase2a UTSW 8 84908848 missense probably damaging 1.00
R4922:Dnase2a UTSW 8 84908996 unclassified probably null
R5183:Dnase2a UTSW 8 84909578 intron probably benign
R6239:Dnase2a UTSW 8 84908879 splice site probably null
R6951:Dnase2a UTSW 8 84909625 missense possibly damaging 0.93
R7215:Dnase2a UTSW 8 84909770 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCACGGATGAAGCCTATC -3'
(R):5'- CCGTGAAGACATGAGGTTGG -3'

Sequencing Primer
(F):5'- ATGAAGCCTATCCGGAGCTG -3'
(R):5'- TTGGGGGAGAGAAGGAATCTG -3'
Posted On2014-06-30