Incidental Mutation 'R1870:Usp34'
ID 210668
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 039892-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R1870 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23314479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 807 (H807R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000137823
AA Change: H807R

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: H807R

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: H788R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: H788R

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,134 (GRCm39) E1332D probably benign Het
Abca5 C A 11: 110,220,043 (GRCm39) V8L probably benign Het
Abcc8 C T 7: 45,773,339 (GRCm39) E797K probably benign Het
Acd C A 8: 106,425,039 (GRCm39) probably null Het
Adam34l A T 8: 44,078,132 (GRCm39) Y697* probably null Het
Adamts12 T C 15: 11,311,240 (GRCm39) S1166P probably benign Het
Alox12b T C 11: 69,049,199 (GRCm39) Y83H possibly damaging Het
Antxr2 A T 5: 98,178,297 (GRCm39) S38T probably damaging Het
Aox1 A G 1: 58,115,262 (GRCm39) E749G probably damaging Het
Arpc1a T A 5: 145,043,901 (GRCm39) C344S possibly damaging Het
Bcan T C 3: 87,902,908 (GRCm39) Y290C probably damaging Het
Bod1l G A 5: 41,991,018 (GRCm39) S179F possibly damaging Het
Catsper3 A C 13: 55,953,561 (GRCm39) D224A probably damaging Het
Ccar2 A G 14: 70,377,946 (GRCm39) S680P probably damaging Het
Ccdc18 A G 5: 108,368,703 (GRCm39) H1275R possibly damaging Het
Ccdc40 T C 11: 119,150,730 (GRCm39) M1011T possibly damaging Het
Cfap46 T A 7: 139,263,386 (GRCm39) D17V probably damaging Het
Csn1s2a T C 5: 87,926,058 (GRCm39) F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 (GRCm39) N750K possibly damaging Het
Cyb5r4 A G 9: 86,922,462 (GRCm39) D157G probably benign Het
D130040H23Rik T A 8: 69,755,354 (GRCm39) I253N probably benign Het
Dennd4a C T 9: 64,804,516 (GRCm39) A1285V probably benign Het
Dlat A G 9: 50,548,874 (GRCm39) S561P probably damaging Het
Dlgap2 T A 8: 14,823,347 (GRCm39) V522E probably damaging Het
Dnah5 T A 15: 28,331,859 (GRCm39) Y2148* probably null Het
Dnase2a T C 8: 85,635,392 (GRCm39) probably benign Het
Elapor2 A G 5: 9,468,007 (GRCm39) E225G probably damaging Het
Fam83f T C 15: 80,574,113 (GRCm39) probably benign Het
Firrm G A 1: 163,792,363 (GRCm39) L545F probably damaging Het
Foxi1 A T 11: 34,157,937 (GRCm39) N29K possibly damaging Het
Galk2 T C 2: 125,817,183 (GRCm39) L324P probably benign Het
Gdpd4 G A 7: 97,622,162 (GRCm39) V214I probably benign Het
Gfra3 C T 18: 34,844,373 (GRCm39) A56T probably damaging Het
Glyctk A G 9: 106,032,547 (GRCm39) S489P probably damaging Het
Izumo4 A T 10: 80,539,569 (GRCm39) I135F probably damaging Het
Krt87 T A 15: 101,385,071 (GRCm39) T342S probably benign Het
L1td1 T A 4: 98,625,714 (GRCm39) D636E possibly damaging Het
Letm2 A G 8: 26,086,460 (GRCm39) probably benign Het
Lpin1 A G 12: 16,591,744 (GRCm39) F828L probably damaging Het
Lrrc37 T C 11: 103,511,431 (GRCm39) D179G unknown Het
Mdn1 T A 4: 32,763,339 (GRCm39) D5146E probably damaging Het
Megf10 T A 18: 57,324,257 (GRCm39) Y99* probably null Het
Men1 A G 19: 6,387,660 (GRCm39) D285G probably damaging Het
Mertk T G 2: 128,643,116 (GRCm39) D838E probably benign Het
Mta1 T C 12: 113,091,694 (GRCm39) S266P possibly damaging Het
Mta3 G A 17: 84,089,397 (GRCm39) V320M probably damaging Het
Nlrp9c G A 7: 26,084,245 (GRCm39) Q445* probably null Het
Or2m12 A T 16: 19,105,357 (GRCm39) N45K probably damaging Het
Or51e1 T C 7: 102,358,961 (GRCm39) I165T possibly damaging Het
Or8b38 A T 9: 37,972,646 (GRCm39) K10I probably benign Het
Or8d6 T G 9: 39,854,117 (GRCm39) I187R probably damaging Het
Pbrm1 T A 14: 30,828,132 (GRCm39) L1320I probably damaging Het
Pdzd2 G T 15: 12,457,972 (GRCm39) T297K probably damaging Het
Pfas T C 11: 68,882,795 (GRCm39) D782G probably damaging Het
Pik3c3 T C 18: 30,426,185 (GRCm39) probably null Het
Pira2 T C 7: 3,847,452 (GRCm39) N79S probably damaging Het
Pkdrej G T 15: 85,700,632 (GRCm39) T1768K probably damaging Het
Plcb3 T C 19: 6,940,353 (GRCm39) I439V probably benign Het
Pold4 T A 19: 4,282,593 (GRCm39) Y58* probably null Het
Ppef2 T G 5: 92,398,371 (GRCm39) Q49P probably damaging Het
Ralgapa1 T A 12: 55,723,817 (GRCm39) I2026F possibly damaging Het
Rest T A 5: 77,416,209 (GRCm39) V141E possibly damaging Het
Rnf139 T C 15: 58,771,202 (GRCm39) V409A probably benign Het
Rnpc3 T C 3: 113,404,704 (GRCm39) probably benign Het
S100a10 A T 3: 93,468,377 (GRCm39) E36V probably benign Het
S1pr3 A C 13: 51,573,952 (GRCm39) K378Q probably benign Het
Scaper T A 9: 55,593,222 (GRCm39) I472F probably damaging Het
Sgcg G A 14: 61,477,896 (GRCm39) probably benign Het
Shank1 A T 7: 43,991,539 (GRCm39) R69* probably null Het
Shoc1 G A 4: 59,054,142 (GRCm39) probably benign Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Slc25a54 T A 3: 108,987,932 (GRCm39) Y24* probably null Het
Slc29a4 T C 5: 142,707,243 (GRCm39) *529R probably null Het
Slc41a2 G A 10: 83,137,029 (GRCm39) Q293* probably null Het
Slc4a7 T C 14: 14,737,509 (GRCm38) probably null Het
Slfn9 G T 11: 82,872,402 (GRCm39) T778N probably benign Het
Ssr2 T C 3: 88,483,949 (GRCm39) probably benign Het
Tecrl T A 5: 83,502,706 (GRCm39) T33S probably benign Het
Tnfrsf9 T A 4: 151,018,804 (GRCm39) C158* probably null Het
Tradd T C 8: 105,985,792 (GRCm39) E253G possibly damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vmn2r27 T C 6: 124,201,170 (GRCm39) I262M probably benign Het
Vps13a A G 19: 16,737,316 (GRCm39) V91A probably damaging Het
Vwf C T 6: 125,619,902 (GRCm39) R1527C probably damaging Het
Wwc1 C T 11: 35,752,772 (GRCm39) G763D probably damaging Het
Zfp526 T G 7: 24,924,594 (GRCm39) D284E possibly damaging Het
Zfp646 T C 7: 127,483,021 (GRCm39) F1733L possibly damaging Het
Zfp90 A G 8: 107,145,755 (GRCm39) H29R probably benign Het
Zkscan4 A G 13: 21,668,104 (GRCm39) E185G probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGGAAGTGAGTTCTGC -3'
(R):5'- GTGGAGTGAACCAAGACCTTTGAG -3'

Sequencing Primer
(F):5'- CTCACTTAGCACAAGGTTCTCAGG -3'
(R):5'- CTTTGAGGTACACTAGCAACAATC -3'
Posted On 2014-06-30