Mutagenetix > Incidental Mutations

Incidental Mutation 'R1870:Abca5'

210677

Institutional Source

Beutler Lab

Gene Symbol

Abca5

Ensembl Gene

ENSMUSG00000018800

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 5

Synonyms

ABC13, B930033A02Rik

MMRRC Submission

039892-MU

Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R1870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110269369-110337716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 110329217 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 8 (V8L)

Ref Sequence

ENSEMBL: ENSMUSP00000118328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714] [ENSMUST00000134721]

Predicted Effect

probably benign
Transcript: ENSMUST00000043961
AA Change: V8L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: V8L

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	29	416	4.3e-33	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
low complexity region	1262	1267	N/A	INTRINSIC
AAA	1325	1512	3.52e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124714
AA Change: V8L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: V8L

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	30	416	9.5e-32	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
transmembrane domain	1019	1041	N/A	INTRINSIC
transmembrane domain	1074	1096	N/A	INTRINSIC
transmembrane domain	1103	1125	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
transmembrane domain	1165	1187	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127318

Predicted Effect

probably benign
Transcript: ENSMUST00000134721
AA Change: V8L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000118328
Gene: ENSMUSG00000018800
AA Change: V8L

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148984

Meta Mutation Damage Score

0.0866

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.1%
20x: 92.1%

Validation Efficiency

97% (96/99)

MGI Phenotype

Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	G	5: 9,418,007	E225G	probably damaging	Het
Abca13	A	T	11: 9,292,134	E1332D	probably benign	Het
Abcc8	C	T	7: 46,123,915	E797K	probably benign	Het
Acd	C	A	8: 105,698,407		probably null	Het
Adamts12	T	C	15: 11,311,154	S1166P	probably benign	Het
AI481877	G	A	4: 59,054,142		probably benign	Het
Alox12b	T	C	11: 69,158,373	Y83H	possibly damaging	Het
Antxr2	A	T	5: 98,030,438	S38T	probably damaging	Het
Aox1	A	G	1: 58,076,103	E749G	probably damaging	Het
Arpc1a	T	A	5: 145,107,091	C344S	possibly damaging	Het
BC055324	G	A	1: 163,964,794	L545F	probably damaging	Het
Bcan	T	C	3: 87,995,601	Y290C	probably damaging	Het
Bod1l	G	A	5: 41,833,675	S179F	possibly damaging	Het
Catsper3	A	C	13: 55,805,748	D224A	probably damaging	Het
Ccar2	A	G	14: 70,140,497	S680P	probably damaging	Het
Ccdc18	A	G	5: 108,220,837	H1275R	possibly damaging	Het
Ccdc40	T	C	11: 119,259,904	M1011T	possibly damaging	Het
Cfap46	T	A	7: 139,683,470	D17V	probably damaging	Het
Csn1s2a	T	C	5: 87,778,199	F45L	probably benign	Het
Cwf19l2	T	G	9: 3,458,802	N750K	possibly damaging	Het
Cyb5r4	A	G	9: 87,040,409	D157G	probably benign	Het
D130040H23Rik	T	A	8: 69,302,702	I253N	probably benign	Het
Dennd4a	C	T	9: 64,897,234	A1285V	probably benign	Het
Dlat	A	G	9: 50,637,574	S561P	probably damaging	Het
Dlgap2	T	A	8: 14,773,347	V522E	probably damaging	Het
Dnah5	T	A	15: 28,331,713	Y2148*	probably null	Het
Dnase2a	T	C	8: 84,908,763		probably benign	Het
Fam83f	T	C	15: 80,689,912		probably benign	Het
Foxi1	A	T	11: 34,207,937	N29K	possibly damaging	Het
Galk2	T	C	2: 125,975,263	L324P	probably benign	Het
Gdpd4	G	A	7: 97,972,955	V214I	probably benign	Het
Gfra3	C	T	18: 34,711,320	A56T	probably damaging	Het
Glyctk	A	G	9: 106,155,348	S489P	probably damaging	Het
Gm5346	A	T	8: 43,625,095	Y697*	probably null	Het
Gm884	T	C	11: 103,620,605	D179G	unknown	Het
Izumo4	A	T	10: 80,703,735	I135F	probably damaging	Het
Krt83	T	A	15: 101,487,190	T342S	probably benign	Het
L1td1	T	A	4: 98,737,477	D636E	possibly damaging	Het
Letm2	A	G	8: 25,596,444		probably benign	Het
Lpin1	A	G	12: 16,541,743	F828L	probably damaging	Het
Mdn1	T	A	4: 32,763,339	D5146E	probably damaging	Het
Megf10	T	A	18: 57,191,185	Y99*	probably null	Het
Men1	A	G	19: 6,337,630	D285G	probably damaging	Het
Mertk	T	G	2: 128,801,196	D838E	probably benign	Het
Mta1	T	C	12: 113,128,074	S266P	possibly damaging	Het
Mta3	G	A	17: 83,781,968	V320M	probably damaging	Het
Nlrp9c	G	A	7: 26,384,820	Q445*	probably null	Het
Olfr164	A	T	16: 19,286,607	N45K	probably damaging	Het
Olfr558	T	C	7: 102,709,754	I165T	possibly damaging	Het
Olfr885	A	T	9: 38,061,350	K10I	probably benign	Het
Olfr974	T	G	9: 39,942,821	I187R	probably damaging	Het
Pbrm1	T	A	14: 31,106,175	L1320I	probably damaging	Het
Pdzd2	G	T	15: 12,457,886	T297K	probably damaging	Het
Pfas	T	C	11: 68,991,969	D782G	probably damaging	Het
Pik3c3	T	C	18: 30,293,132		probably null	Het
Pira2	T	C	7: 3,844,453	N79S	probably damaging	Het
Pkdrej	G	T	15: 85,816,431	T1768K	probably damaging	Het
Plcb3	T	C	19: 6,962,985	I439V	probably benign	Het
Pold4	T	A	19: 4,232,539	Y58*	probably null	Het
Ppef2	T	G	5: 92,250,512	Q49P	probably damaging	Het
Ralgapa1	T	A	12: 55,677,032	I2026F	possibly damaging	Het
Rest	T	A	5: 77,268,362	V141E	possibly damaging	Het
Rnf139	T	C	15: 58,899,353	V409A	probably benign	Het
Rnpc3	T	C	3: 113,611,055		probably benign	Het
S100a10	A	T	3: 93,561,070	E36V	probably benign	Het
S1pr3	A	C	13: 51,419,916	K378Q	probably benign	Het
Scaper	T	A	9: 55,685,938	I472F	probably damaging	Het
Sgcg	G	A	14: 61,240,447		probably benign	Het
Shank1	A	T	7: 44,342,115	R69*	probably null	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Slc25a54	T	A	3: 109,080,616	Y24*	probably null	Het
Slc29a4	T	C	5: 142,721,488	*529R	probably null	Het
Slc41a2	G	A	10: 83,301,165	Q293*	probably null	Het
Slc4a7	T	C	14: 14,737,509		probably null	Het
Slfn9	G	T	11: 82,981,576	T778N	probably benign	Het
Ssr2	T	C	3: 88,576,642		probably benign	Het
Tecrl	T	A	5: 83,354,859	T33S	probably benign	Het
Tnfrsf9	T	A	4: 150,934,347	C158*	probably null	Het
Tradd	T	C	8: 105,259,160	E253G	possibly damaging	Het
Usp34	A	G	11: 23,364,479	H807R	probably benign	Het
Vmn2r27	T	C	6: 124,224,211	I262M	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps13a	A	G	19: 16,759,952	V91A	probably damaging	Het
Vwf	C	T	6: 125,642,939	R1527C	probably damaging	Het
Wwc1	C	T	11: 35,861,945	G763D	probably damaging	Het
Zfp526	T	G	7: 25,225,169	D284E	possibly damaging	Het
Zfp646	T	C	7: 127,883,849	F1733L	possibly damaging	Het
Zfp90	A	G	8: 106,419,123	H29R	probably benign	Het
Zkscan4	A	G	13: 21,483,934	E185G	probably benign	Het

Other mutations in Abca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Abca5	APN	11	110309450	critical splice acceptor site	probably null
IGL00675:Abca5	APN	11	110304985	missense	probably damaging	1.00
IGL01512:Abca5	APN	11	110317823	missense	probably benign	0.40
IGL01559:Abca5	APN	11	110272526	missense	probably benign
IGL01584:Abca5	APN	11	110304923	missense	probably damaging	0.98
IGL01604:Abca5	APN	11	110277636	missense	possibly damaging	0.47
IGL01828:Abca5	APN	11	110287695	missense	probably benign
IGL01880:Abca5	APN	11	110293263	missense	probably benign	0.01
IGL02054:Abca5	APN	11	110292123	missense	probably damaging	0.99
IGL02074:Abca5	APN	11	110293350	missense	probably benign	0.00
IGL02233:Abca5	APN	11	110274344	nonsense	probably null
IGL02245:Abca5	APN	11	110298169	nonsense	probably null
IGL02317:Abca5	APN	11	110327761	missense	probably benign	0.09
IGL02352:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02359:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02390:Abca5	APN	11	110296551	missense	probably benign
IGL02600:Abca5	APN	11	110309438	missense	probably benign	0.02
IGL02639:Abca5	APN	11	110288073	missense	possibly damaging	0.79
IGL03000:Abca5	APN	11	110317814	missense	probably benign	0.04
IGL03074:Abca5	APN	11	110310275	missense	probably benign	0.01
IGL03078:Abca5	APN	11	110276545	nonsense	probably null
IGL03342:Abca5	APN	11	110287691	missense	possibly damaging	0.94
IGL03368:Abca5	APN	11	110313522	splice site	probably benign
atles	UTSW	11	110299929	missense	probably damaging	0.99
Demento	UTSW	11	110310233	missense	probably damaging	1.00
jones	UTSW	11	110288058	splice site	probably null
R0106:Abca5	UTSW	11	110319825	missense	probably damaging	1.00
R0116:Abca5	UTSW	11	110276505	missense	probably damaging	1.00
R0305:Abca5	UTSW	11	110273311	splice site	probably benign
R0550:Abca5	UTSW	11	110293840	missense	probably damaging	1.00
R0578:Abca5	UTSW	11	110276489	nonsense	probably null
R0587:Abca5	UTSW	11	110311377	missense	probably benign	0.00
R0610:Abca5	UTSW	11	110301527	missense	probably benign	0.00
R0617:Abca5	UTSW	11	110279689	missense	probably damaging	0.98
R0667:Abca5	UTSW	11	110327811	missense	probably benign	0.00
R0844:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R1273:Abca5	UTSW	11	110326665	missense	probably benign	0.01
R1463:Abca5	UTSW	11	110314558	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299978	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299986	missense	possibly damaging	0.73
R1687:Abca5	UTSW	11	110293888	missense	probably benign	0.32
R1759:Abca5	UTSW	11	110293848	missense	probably benign
R2006:Abca5	UTSW	11	110313449	missense	probably benign
R2039:Abca5	UTSW	11	110299929	missense	probably damaging	0.99
R2076:Abca5	UTSW	11	110287652	missense	probably benign	0.10
R2136:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R2154:Abca5	UTSW	11	110292174	missense	probably benign	0.00
R2273:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2274:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2275:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2328:Abca5	UTSW	11	110276521	missense	probably damaging	0.99
R3702:Abca5	UTSW	11	110288058	splice site	probably null
R3768:Abca5	UTSW	11	110313391	missense	probably benign	0.01
R3872:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3873:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3874:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3875:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R4347:Abca5	UTSW	11	110299968	missense	probably damaging	1.00
R4429:Abca5	UTSW	11	110311410	missense	probably benign	0.00
R4790:Abca5	UTSW	11	110311410	missense	possibly damaging	0.63
R4812:Abca5	UTSW	11	110301821	missense	probably damaging	1.00
R4833:Abca5	UTSW	11	110279316	missense	probably benign	0.00
R4883:Abca5	UTSW	11	110326631	missense	probably damaging	1.00
R5000:Abca5	UTSW	11	110310224	missense	probably damaging	1.00
R5004:Abca5	UTSW	11	110279376	missense	probably damaging	0.99
R5066:Abca5	UTSW	11	110309350	intron	probably benign
R5230:Abca5	UTSW	11	110319860	missense	probably benign
R5321:Abca5	UTSW	11	110327825	missense	probably benign
R5350:Abca5	UTSW	11	110319796	nonsense	probably null
R5414:Abca5	UTSW	11	110314622	missense	probably damaging	1.00
R5437:Abca5	UTSW	11	110319796	nonsense	probably null
R5451:Abca5	UTSW	11	110319796	nonsense	probably null
R5453:Abca5	UTSW	11	110319796	nonsense	probably null
R5488:Abca5	UTSW	11	110292183	missense	probably benign	0.00
R5636:Abca5	UTSW	11	110301536	missense	probably benign	0.00
R5805:Abca5	UTSW	11	110279390	missense	probably benign	0.06
R5900:Abca5	UTSW	11	110279156	missense	possibly damaging	0.92
R6152:Abca5	UTSW	11	110313361	missense	probably damaging	1.00
R6167:Abca5	UTSW	11	110292105	missense	probably benign	0.10
R6343:Abca5	UTSW	11	110314552	missense	probably damaging	1.00
R6425:Abca5	UTSW	11	110329232	missense	possibly damaging	0.75
R6493:Abca5	UTSW	11	110293878	missense	probably benign	0.00
R6498:Abca5	UTSW	11	110292102	missense	possibly damaging	0.70
R6884:Abca5	UTSW	11	110329217	missense	probably damaging	0.96
R6912:Abca5	UTSW	11	110306280	missense	probably benign	0.35
R7084:Abca5	UTSW	11	110301545	missense	probably benign	0.22
R7239:Abca5	UTSW	11	110326704	missense	possibly damaging	0.94
R7490:Abca5	UTSW	11	110277611	missense	possibly damaging	0.95
R7527:Abca5	UTSW	11	110327730	critical splice donor site	probably null
R7702:Abca5	UTSW	11	110276452	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTATCAGATCTCGCTATCATAACC -3'
(R):5'- ATCTGAGAGATGGCTTGTAGC -3'

Sequencing Primer
(F):5'- GAGCTGTCTCTTAAAAGTAGAACAC -3'
(R):5'- AGCATGCTTAACTTCATTTTACCTGG -3'

Posted On

2014-06-30