Incidental Mutation 'R1870:Lpin1'
ID210679
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R1870 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16541743 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 828 (F828L)
Ref Sequence ENSEMBL: ENSMUSP00000152285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect probably damaging
Transcript: ENSMUST00000067124
AA Change: F828L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: F828L

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111067
AA Change: F828L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: F828L

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221230
AA Change: F795L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000221297
AA Change: F828L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000222989
AA Change: F795L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.8744 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Dnase2a T C 8: 84,908,763 probably benign Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Galk2 T C 2: 125,975,263 L324P probably benign Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Men1 A G 19: 6,337,630 D285G probably damaging Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr164 A T 16: 19,286,607 N45K probably damaging Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tnfrsf9 T A 4: 150,934,347 C158* probably null Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0044:Lpin1 UTSW 12 16568529 splice site probably benign
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5024:Lpin1 UTSW 12 16554006 missense probably benign 0.38
R5084:Lpin1 UTSW 12 16576982 missense probably damaging 1.00
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5191:Lpin1 UTSW 12 16580828 missense possibly damaging 0.95
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R5924:Lpin1 UTSW 12 16544657 missense possibly damaging 0.91
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6799:Lpin1 UTSW 12 16561044 missense probably damaging 1.00
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
R7557:Lpin1 UTSW 12 16580792 missense
Predicted Primers PCR Primer
(F):5'- TTCAAAGAAGACCAGAGGCC -3'
(R):5'- TTTCCTGACAGTTGGGCCAAC -3'

Sequencing Primer
(F):5'- GGCCACACCTGATGGGATTTAATC -3'
(R):5'- TCTGGGGAATACACTCAGGTAGTCC -3'
Posted On2014-06-30