Mutagenetix > Incidental Mutation

Incidental Mutation 'R1870:Ralgapa1'

210680

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

039892-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R1870 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55677032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 2026 (I2026F)

Ref Sequence

ENSEMBL: ENSMUSP00000154749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085385
AA Change: I1570F

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: I1570F

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110687
AA Change: I1570F

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: I1570F

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219432
AA Change: I1617F

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000219566

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220017

Predicted Effect

probably benign
Transcript: ENSMUST00000220367
AA Change: I1570F

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226244
AA Change: I2026F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.3706

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 95.1%
20x: 92.1%

Validation Efficiency

97% (96/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	G	5: 9,418,007	E225G	probably damaging	Het
Abca13	A	T	11: 9,292,134	E1332D	probably benign	Het
Abca5	C	A	11: 110,329,217	V8L	probably benign	Het
Abcc8	C	T	7: 46,123,915	E797K	probably benign	Het
Acd	C	A	8: 105,698,407		probably null	Het
Adamts12	T	C	15: 11,311,154	S1166P	probably benign	Het
AI481877	G	A	4: 59,054,142		probably benign	Het
Alox12b	T	C	11: 69,158,373	Y83H	possibly damaging	Het
Antxr2	A	T	5: 98,030,438	S38T	probably damaging	Het
Aox1	A	G	1: 58,076,103	E749G	probably damaging	Het
Arpc1a	T	A	5: 145,107,091	C344S	possibly damaging	Het
BC055324	G	A	1: 163,964,794	L545F	probably damaging	Het
Bcan	T	C	3: 87,995,601	Y290C	probably damaging	Het
Bod1l	G	A	5: 41,833,675	S179F	possibly damaging	Het
Catsper3	A	C	13: 55,805,748	D224A	probably damaging	Het
Ccar2	A	G	14: 70,140,497	S680P	probably damaging	Het
Ccdc18	A	G	5: 108,220,837	H1275R	possibly damaging	Het
Ccdc40	T	C	11: 119,259,904	M1011T	possibly damaging	Het
Cfap46	T	A	7: 139,683,470	D17V	probably damaging	Het
Csn1s2a	T	C	5: 87,778,199	F45L	probably benign	Het
Cwf19l2	T	G	9: 3,458,802	N750K	possibly damaging	Het
Cyb5r4	A	G	9: 87,040,409	D157G	probably benign	Het
D130040H23Rik	T	A	8: 69,302,702	I253N	probably benign	Het
Dennd4a	C	T	9: 64,897,234	A1285V	probably benign	Het
Dlat	A	G	9: 50,637,574	S561P	probably damaging	Het
Dlgap2	T	A	8: 14,773,347	V522E	probably damaging	Het
Dnah5	T	A	15: 28,331,713	Y2148*	probably null	Het
Dnase2a	T	C	8: 84,908,763		probably benign	Het
Fam83f	T	C	15: 80,689,912		probably benign	Het
Foxi1	A	T	11: 34,207,937	N29K	possibly damaging	Het
Galk2	T	C	2: 125,975,263	L324P	probably benign	Het
Gdpd4	G	A	7: 97,972,955	V214I	probably benign	Het
Gfra3	C	T	18: 34,711,320	A56T	probably damaging	Het
Glyctk	A	G	9: 106,155,348	S489P	probably damaging	Het
Gm5346	A	T	8: 43,625,095	Y697*	probably null	Het
Gm884	T	C	11: 103,620,605	D179G	unknown	Het
Izumo4	A	T	10: 80,703,735	I135F	probably damaging	Het
Krt83	T	A	15: 101,487,190	T342S	probably benign	Het
L1td1	T	A	4: 98,737,477	D636E	possibly damaging	Het
Letm2	A	G	8: 25,596,444		probably benign	Het
Lpin1	A	G	12: 16,541,743	F828L	probably damaging	Het
Mdn1	T	A	4: 32,763,339	D5146E	probably damaging	Het
Megf10	T	A	18: 57,191,185	Y99*	probably null	Het
Men1	A	G	19: 6,337,630	D285G	probably damaging	Het
Mertk	T	G	2: 128,801,196	D838E	probably benign	Het
Mta1	T	C	12: 113,128,074	S266P	possibly damaging	Het
Mta3	G	A	17: 83,781,968	V320M	probably damaging	Het
Nlrp9c	G	A	7: 26,384,820	Q445*	probably null	Het
Olfr164	A	T	16: 19,286,607	N45K	probably damaging	Het
Olfr558	T	C	7: 102,709,754	I165T	possibly damaging	Het
Olfr885	A	T	9: 38,061,350	K10I	probably benign	Het
Olfr974	T	G	9: 39,942,821	I187R	probably damaging	Het
Pbrm1	T	A	14: 31,106,175	L1320I	probably damaging	Het
Pdzd2	G	T	15: 12,457,886	T297K	probably damaging	Het
Pfas	T	C	11: 68,991,969	D782G	probably damaging	Het
Pik3c3	T	C	18: 30,293,132		probably null	Het
Pira2	T	C	7: 3,844,453	N79S	probably damaging	Het
Pkdrej	G	T	15: 85,816,431	T1768K	probably damaging	Het
Plcb3	T	C	19: 6,962,985	I439V	probably benign	Het
Pold4	T	A	19: 4,232,539	Y58*	probably null	Het
Ppef2	T	G	5: 92,250,512	Q49P	probably damaging	Het
Rest	T	A	5: 77,268,362	V141E	possibly damaging	Het
Rnf139	T	C	15: 58,899,353	V409A	probably benign	Het
Rnpc3	T	C	3: 113,611,055		probably benign	Het
S100a10	A	T	3: 93,561,070	E36V	probably benign	Het
S1pr3	A	C	13: 51,419,916	K378Q	probably benign	Het
Scaper	T	A	9: 55,685,938	I472F	probably damaging	Het
Sgcg	G	A	14: 61,240,447		probably benign	Het
Shank1	A	T	7: 44,342,115	R69*	probably null	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Slc25a54	T	A	3: 109,080,616	Y24*	probably null	Het
Slc29a4	T	C	5: 142,721,488	*529R	probably null	Het
Slc41a2	G	A	10: 83,301,165	Q293*	probably null	Het
Slc4a7	T	C	14: 14,737,509		probably null	Het
Slfn9	G	T	11: 82,981,576	T778N	probably benign	Het
Ssr2	T	C	3: 88,576,642		probably benign	Het
Tecrl	T	A	5: 83,354,859	T33S	probably benign	Het
Tnfrsf9	T	A	4: 150,934,347	C158*	probably null	Het
Tradd	T	C	8: 105,259,160	E253G	possibly damaging	Het
Usp34	A	G	11: 23,364,479	H807R	probably benign	Het
Vmn2r27	T	C	6: 124,224,211	I262M	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps13a	A	G	19: 16,759,952	V91A	probably damaging	Het
Vwf	C	T	6: 125,642,939	R1527C	probably damaging	Het
Wwc1	C	T	11: 35,861,945	G763D	probably damaging	Het
Zfp526	T	G	7: 25,225,169	D284E	possibly damaging	Het
Zfp646	T	C	7: 127,883,849	F1733L	possibly damaging	Het
Zfp90	A	G	8: 106,419,123	H29R	probably benign	Het
Zkscan4	A	G	13: 21,483,934	E185G	probably benign	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGATGTAGGAGGCTCTTCCG -3'
(R):5'- CATCTGGTGAATCACTTGGGC -3'

Sequencing Primer
(F):5'- GTTTCTCTTGGTCAGACATTGAAAG -3'
(R):5'- CACTTGGGCCATTATCCAATGAGTG -3'

Posted On

2014-06-30