Incidental Mutation 'R0122:Baz2b'
ID21074
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission 038407-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R0122 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 59913619 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090925
AA Change: P1514Q

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: P1514Q

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112550
AA Change: P1514Q

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: P1514Q

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130637
SMART Domains Protein: ENSMUSP00000119690
Gene: ENSMUSG00000026987

DomainStartEndE-ValueType
Pfam:WHIM3 2 37 1.8e-13 PFAM
low complexity region 162 173 N/A INTRINSIC
PHD 214 253 2.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152639
Meta Mutation Damage Score 0.1418 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Adam12 T A 7: 134,012,348 I60F probably benign Het
Adamts10 A G 17: 33,528,480 probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Adamts7 A G 9: 90,179,421 E360G probably damaging Het
Atn1 A T 6: 124,743,234 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Bloc1s6 G C 2: 122,746,043 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qa T A 4: 136,897,831 T3S probably benign Het
Cacna1e A T 1: 154,443,901 F1351Y probably damaging Het
Car9 C T 4: 43,512,206 A356V probably benign Het
Ccdc116 T A 16: 17,142,734 D73V probably damaging Het
Ces2g T C 8: 104,968,300 Y518H probably damaging Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cmc1 A T 9: 118,065,320 C29S probably damaging Het
Coil T A 11: 88,985,007 probably benign Het
Col3a1 C T 1: 45,340,897 probably benign Het
Cox15 A G 19: 43,748,790 I135T possibly damaging Het
Cyld T C 8: 88,742,292 S564P probably damaging Het
Dnah5 T A 15: 28,378,363 N2948K probably damaging Het
Dnah7a G A 1: 53,397,142 R4014W probably damaging Het
Dnmt3b T C 2: 153,676,698 Y594H probably damaging Het
Dntt A G 19: 41,053,038 K387R possibly damaging Het
Efcab7 G A 4: 99,892,363 probably benign Het
Flvcr1 G T 1: 191,021,226 P250T possibly damaging Het
Gga2 C A 7: 121,991,574 V504L probably damaging Het
Gm12239 T A 11: 56,015,912 noncoding transcript Het
Gm13089 A T 4: 143,698,404 D156E probably benign Het
Gm6327 T C 16: 12,761,026 noncoding transcript Het
Krt26 G T 11: 99,333,719 Y324* probably null Het
Lamb2 A T 9: 108,486,514 H939L probably benign Het
Lipo3 C T 19: 33,622,686 probably benign Het
Mmp1b G A 9: 7,386,689 T145M probably damaging Het
Mrps27 G T 13: 99,365,228 V76L probably benign Het
Mup6 T A 4: 60,003,995 Y29* probably null Het
Nlrc3 T C 16: 3,958,958 K756E probably damaging Het
Nnt T C 13: 119,368,597 H527R probably damaging Het
Nudt8 T C 19: 4,001,306 V59A probably benign Het
Ofcc1 A T 13: 40,280,556 probably null Het
Olfr447 T C 6: 42,911,955 V144A probably benign Het
Olfr638 T C 7: 104,003,358 W28R probably damaging Het
Olfr959 A T 9: 39,572,724 D178E probably damaging Het
Pdgfd T C 9: 6,293,851 S142P probably damaging Het
Pias4 G T 10: 81,157,087 Q22K probably damaging Het
Pin1 T C 9: 20,662,304 I95T probably benign Het
Prickle2 G A 6: 92,411,345 Q359* probably null Het
Qrich2 G T 11: 116,446,813 Q1950K possibly damaging Het
Rab10 C A 12: 3,309,357 G21V probably damaging Het
Rbm27 T A 18: 42,313,968 probably benign Het
Samd4 C A 14: 47,016,560 S160R probably benign Het
Scube3 A C 17: 28,166,528 probably benign Het
Serpinf2 A G 11: 75,436,546 L185P probably damaging Het
Slc16a12 A G 19: 34,674,864 I294T probably benign Het
Slc45a3 T A 1: 131,977,740 M167K probably damaging Het
Sspo T A 6: 48,473,976 L2673Q possibly damaging Het
Supt3 A G 17: 45,003,141 D139G probably damaging Het
Tas1r3 T C 4: 155,860,833 M644V probably benign Het
Tgfbi A G 13: 56,627,968 T276A probably damaging Het
Tmem177 T C 1: 119,910,578 I124V probably benign Het
Tmprss11f G T 5: 86,533,625 probably benign Het
Tmprss3 G A 17: 31,193,902 probably benign Het
Twf1 A G 15: 94,586,549 probably benign Het
Uba52 T A 8: 70,509,301 Q166L probably damaging Het
Ubr3 G T 2: 69,979,412 G1242V probably damaging Het
Unc13d C T 11: 116,065,482 S835N probably benign Het
Ush2a A G 1: 188,948,455 K4877E possibly damaging Het
Vmn2r98 A G 17: 19,066,400 I387V probably benign Het
Vps11 A T 9: 44,354,512 I490N probably damaging Het
Vstm4 T A 14: 32,863,811 probably null Het
Zfp110 C A 7: 12,848,597 H391N possibly damaging Het
Zfp212 C T 6: 47,931,023 P312L possibly damaging Het
Zfp329 A T 7: 12,810,987 H203Q probably damaging Het
Zscan12 G A 13: 21,368,969 G321E probably damaging Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 intron probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7851:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7933:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7934:Baz2b UTSW 2 59936716 missense probably damaging 0.98
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGACAGAAATCCTGGCTGCTTG -3'
(R):5'- GACAGACGCCAGTCTCTTTAGCTC -3'

Sequencing Primer
(F):5'- CTGGCACAGTGTGTTTTGTCA -3'
(R):5'- TGTGGGAAGTTCTACAGTCCTC -3'
Posted On2013-04-11