Incidental Mutation 'R0122:Ubr3'
ID21075
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission 038407-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0122 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69979412 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1242 (G1242V)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably damaging
Transcript: ENSMUST00000055758
AA Change: G1243V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: G1243V

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112251
AA Change: G1242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: G1242V

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Meta Mutation Damage Score 0.1910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Adam12 T A 7: 134,012,348 I60F probably benign Het
Adamts10 A G 17: 33,528,480 probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Adamts7 A G 9: 90,179,421 E360G probably damaging Het
Atn1 A T 6: 124,743,234 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Baz2b G T 2: 59,913,619 probably null Het
Bloc1s6 G C 2: 122,746,043 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qa T A 4: 136,897,831 T3S probably benign Het
Cacna1e A T 1: 154,443,901 F1351Y probably damaging Het
Car9 C T 4: 43,512,206 A356V probably benign Het
Ccdc116 T A 16: 17,142,734 D73V probably damaging Het
Ces2g T C 8: 104,968,300 Y518H probably damaging Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cmc1 A T 9: 118,065,320 C29S probably damaging Het
Coil T A 11: 88,985,007 probably benign Het
Col3a1 C T 1: 45,340,897 probably benign Het
Cox15 A G 19: 43,748,790 I135T possibly damaging Het
Cyld T C 8: 88,742,292 S564P probably damaging Het
Dnah5 T A 15: 28,378,363 N2948K probably damaging Het
Dnah7a G A 1: 53,397,142 R4014W probably damaging Het
Dnmt3b T C 2: 153,676,698 Y594H probably damaging Het
Dntt A G 19: 41,053,038 K387R possibly damaging Het
Efcab7 G A 4: 99,892,363 probably benign Het
Flvcr1 G T 1: 191,021,226 P250T possibly damaging Het
Gga2 C A 7: 121,991,574 V504L probably damaging Het
Gm12239 T A 11: 56,015,912 noncoding transcript Het
Gm13089 A T 4: 143,698,404 D156E probably benign Het
Gm6327 T C 16: 12,761,026 noncoding transcript Het
Krt26 G T 11: 99,333,719 Y324* probably null Het
Lamb2 A T 9: 108,486,514 H939L probably benign Het
Lipo3 C T 19: 33,622,686 probably benign Het
Mmp1b G A 9: 7,386,689 T145M probably damaging Het
Mrps27 G T 13: 99,365,228 V76L probably benign Het
Mup6 T A 4: 60,003,995 Y29* probably null Het
Nlrc3 T C 16: 3,958,958 K756E probably damaging Het
Nnt T C 13: 119,368,597 H527R probably damaging Het
Nudt8 T C 19: 4,001,306 V59A probably benign Het
Ofcc1 A T 13: 40,280,556 probably null Het
Olfr447 T C 6: 42,911,955 V144A probably benign Het
Olfr638 T C 7: 104,003,358 W28R probably damaging Het
Olfr959 A T 9: 39,572,724 D178E probably damaging Het
Pdgfd T C 9: 6,293,851 S142P probably damaging Het
Pias4 G T 10: 81,157,087 Q22K probably damaging Het
Pin1 T C 9: 20,662,304 I95T probably benign Het
Prickle2 G A 6: 92,411,345 Q359* probably null Het
Qrich2 G T 11: 116,446,813 Q1950K possibly damaging Het
Rab10 C A 12: 3,309,357 G21V probably damaging Het
Rbm27 T A 18: 42,313,968 probably benign Het
Samd4 C A 14: 47,016,560 S160R probably benign Het
Scube3 A C 17: 28,166,528 probably benign Het
Serpinf2 A G 11: 75,436,546 L185P probably damaging Het
Slc16a12 A G 19: 34,674,864 I294T probably benign Het
Slc45a3 T A 1: 131,977,740 M167K probably damaging Het
Sspo T A 6: 48,473,976 L2673Q possibly damaging Het
Supt3 A G 17: 45,003,141 D139G probably damaging Het
Tas1r3 T C 4: 155,860,833 M644V probably benign Het
Tgfbi A G 13: 56,627,968 T276A probably damaging Het
Tmem177 T C 1: 119,910,578 I124V probably benign Het
Tmprss11f G T 5: 86,533,625 probably benign Het
Tmprss3 G A 17: 31,193,902 probably benign Het
Twf1 A G 15: 94,586,549 probably benign Het
Uba52 T A 8: 70,509,301 Q166L probably damaging Het
Unc13d C T 11: 116,065,482 S835N probably benign Het
Ush2a A G 1: 188,948,455 K4877E possibly damaging Het
Vmn2r98 A G 17: 19,066,400 I387V probably benign Het
Vps11 A T 9: 44,354,512 I490N probably damaging Het
Vstm4 T A 14: 32,863,811 probably null Het
Zfp110 C A 7: 12,848,597 H391N possibly damaging Het
Zfp212 C T 6: 47,931,023 P312L possibly damaging Het
Zfp329 A T 7: 12,810,987 H203Q probably damaging Het
Zscan12 G A 13: 21,368,969 G321E probably damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 intron probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGTGGGGAGTGCATAATGAAGAGG -3'
(R):5'- GCAATCTACATGCTGTGTCAGGAACTA -3'

Sequencing Primer
(F):5'- AACCACAAGTTTCTGAGGCC -3'
(R):5'- TGTGTCAGGAACTACTTCTGC -3'
Posted On2013-04-11