Mutagenetix > Incidental Mutations

Incidental Mutation 'R1871:Usp34'

210762

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

039893-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R1871 (G1)

Quality Score

208

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23364479 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 807 (H807R)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180046]

Predicted Effect

probably benign
Transcript: ENSMUST00000137823
AA Change: H807R

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: H807R

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000180046
AA Change: H788R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: H788R

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.2%

Validation Efficiency

97% (87/90)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	G	5: 9,418,007	E225G	probably damaging	Het
A930009A15Rik	A	G	10: 115,579,794		probably null	Het
Abca13	A	T	11: 9,292,134	E1332D	probably benign	Het
Abce1	G	A	8: 79,685,268	Q588*	probably null	Het
Acads	A	T	5: 115,117,642	C45S	probably damaging	Het
Adamts12	T	C	15: 11,311,154	S1166P	probably benign	Het
Ano4	T	A	10: 88,993,027	I517F	probably damaging	Het
Arpc1a	T	A	5: 145,107,091	C344S	possibly damaging	Het
Blk	A	T	14: 63,375,915	S381R	possibly damaging	Het
Capn15	C	A	17: 25,964,229	W426L	probably damaging	Het
Chd6	T	C	2: 160,990,256	T999A	probably damaging	Het
Clca3a2	A	G	3: 144,797,637	Y851H	probably benign	Het
Crp	T	A	1: 172,698,605	W86R	possibly damaging	Het
Ctnnal1	G	A	4: 56,812,534	L705F	probably benign	Het
Cyp2c66	A	G	19: 39,163,414	D191G	possibly damaging	Het
Cyp4f37	A	G	17: 32,634,665	D441G	probably damaging	Het
D130040H23Rik	T	A	8: 69,302,702	I253N	probably benign	Het
Dnah5	T	A	15: 28,331,713	Y2148*	probably null	Het
Eef1g	A	T	19: 8,977,966	D393V	possibly damaging	Het
Ephx2	A	T	14: 66,084,734	I538N	probably damaging	Het
Fat4	T	A	3: 38,981,072	S2958T	possibly damaging	Het
Foxi1	A	T	11: 34,207,937	N29K	possibly damaging	Het
Gm10287	G	T	3: 149,224,737		noncoding transcript	Het
Gm10801	G	T	2: 98,663,840	S109I	probably benign	Het
Gm5346	A	T	8: 43,625,095	Y697*	probably null	Het
Gmcl1	T	C	6: 86,697,516	D460G	probably benign	Het
Gpr158	A	G	2: 21,815,615	D641G	probably damaging	Het
Heph	C	A	X: 96,499,084	S561Y	probably benign	Het
Hgfac	A	G	5: 35,042,913	*90W	probably null	Het
Hp1bp3	C	G	4: 138,222,186	P65R	probably damaging	Het
Ighv6-4	T	A	12: 114,406,601	Y58F	probably benign	Het
Jrk	T	C	15: 74,706,563	D291G	possibly damaging	Het
Kdm4d	A	G	9: 14,464,383	Y60H	probably damaging	Het
Khdrbs3	T	C	15: 69,049,442	Y203H	probably damaging	Het
Klhl6	A	T	16: 19,957,043	V255D	possibly damaging	Het
Krt9	C	T	11: 100,190,788	R305H	probably damaging	Het
Lama2	T	G	10: 26,984,494	N2999T	probably damaging	Het
Letm2	A	G	8: 25,596,444		probably benign	Het
Lipa	A	T	19: 34,510,928	L106Q	probably damaging	Het
Llph	A	T	10: 120,231,236	N86I	probably damaging	Het
Lyst	T	A	13: 13,651,712	N1601K	probably benign	Het
Mc1r	T	A	8: 123,407,536	S9R	probably benign	Het
Mfsd14a	A	G	3: 116,641,320	I249T	probably benign	Het
Mtfp1	G	A	11: 4,094,012	R73C	probably benign	Het
Myo1a	A	G	10: 127,719,671	Q877R	probably benign	Het
Nalcn	A	C	14: 123,594,553	V103G	possibly damaging	Het
Ndst3	A	T	3: 123,562,024	F119I	probably damaging	Het
Olfr1008	A	G	2: 85,690,311	N294S	probably damaging	Het
Patl1	T	C	19: 11,925,232		probably benign	Het
Pcdhb2	A	T	18: 37,297,355		probably null	Het
Pcdhb22	A	C	18: 37,519,147	T223P	probably damaging	Het
Pcdhga1	T	A	18: 37,840,090	N907K	probably damaging	Het
Pfas	T	C	11: 68,991,969	D782G	probably damaging	Het
Plpp6	T	C	19: 28,964,284	F95S	probably damaging	Het
Polr2b	T	A	5: 77,326,527		probably benign	Het
Qars	T	G	9: 108,514,116		probably null	Het
Ranbp2	A	G	10: 58,492,561	I2800V	probably damaging	Het
Rnf213	T	C	11: 119,450,129	V3532A	probably benign	Het
Rubcnl	T	C	14: 75,042,409	S411P	possibly damaging	Het
Scn1a	C	A	2: 66,318,025	G1059W	probably damaging	Het
Sgms1	C	T	19: 32,159,882	V95I	probably benign	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Slc29a4	T	C	5: 142,721,488	*529R	probably null	Het
Slfn9	G	T	11: 82,981,576	T778N	probably benign	Het
Sorl1	G	A	9: 41,969,725	Q2167*	probably null	Het
Stkld1	A	G	2: 26,937,973		probably benign	Het
Taar8b	T	C	10: 24,092,002	Y98C	probably damaging	Het
Tecta	G	A	9: 42,337,176	L1977F	probably damaging	Het
Tecta	G	C	9: 42,337,340	T1917R	probably damaging	Het
Topaz1	T	A	9: 122,799,479	S1544T	probably benign	Het
Tpx2	T	C	2: 152,893,603	I717T	probably damaging	Het
Tyk2	A	T	9: 21,121,441	V342E	probably damaging	Het
Ube4a	A	T	9: 44,944,937		probably null	Het
Unc80	A	T	1: 66,510,717	R711S	possibly damaging	Het
Ush2a	C	A	1: 188,826,468	D3631E	probably benign	Het
Vps13a	T	C	19: 16,664,664	T2200A	probably benign	Het
Wif1	A	G	10: 121,084,919	I215M	probably benign	Het
Wnk1	T	C	6: 119,951,089	T1134A	probably damaging	Het
Xxylt1	A	G	16: 30,957,417	V367A	probably damaging	Het
Zfp735	A	T	11: 73,710,586	K119*	probably null	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	synonymous	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AGGGGAAGTGAGTTCTGCTC -3'
(R):5'- ACTAGCAACAATCATAGTCTTAGCC -3'

Sequencing Primer
(F):5'- TCACTTAGCACAAGGTTCTCAGGAG -3'
(R):5'- ATATCAACTGAAGAAATACTAGC -3'

Posted On

2014-06-30