Incidental Mutation 'R1871:Ephx2'
ID210773
Institutional Source Beutler Lab
Gene Symbol Ephx2
Ensembl Gene ENSMUSG00000022040
Gene Nameepoxide hydrolase 2, cytoplasmic
SynonymsEph2, sEP, sEH
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R1871 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66084374-66124500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66084734 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 538 (I538N)
Ref Sequence ENSEMBL: ENSMUSP00000069209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070515] [ENSMUST00000224698] [ENSMUST00000225309]
PDB Structure
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CPU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CIU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CDU INHIBITOR [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000070515
AA Change: I538N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069209
Gene: ENSMUSG00000022040
AA Change: I538N

DomainStartEndE-ValueType
Pfam:Hydrolase 3 197 1.2e-8 PFAM
Pfam:HAD_2 6 203 2.5e-17 PFAM
Pfam:Hydrolase_4 256 529 6.6e-11 PFAM
Pfam:Abhydrolase_1 257 530 7.2e-38 PFAM
Pfam:Abhydrolase_5 258 524 3.5e-14 PFAM
Pfam:Abhydrolase_6 259 536 2.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224698
AA Change: I520N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225309
AA Change: I472N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.5701 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Males homozygous for a targeted null mutation display a significant reduction in blood pressure both in the absence and presence of dietary salt loading. Both sexes exhibit altered arachidonic acid metabolism and reduced renal formation of epoxyeicosatrienoic and dihydroxyeicosatrienoic acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Chd6 T C 2: 160,990,256 T999A probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp2c66 A G 19: 39,163,414 D191G possibly damaging Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Tecta G A 9: 42,337,176 L1977F probably damaging Het
Tecta G C 9: 42,337,340 T1917R probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Unc80 A T 1: 66,510,717 R711S possibly damaging Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Ephx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ephx2 APN 14 66092837 missense probably benign
IGL01143:Ephx2 APN 14 66089522 missense probably damaging 1.00
IGL02058:Ephx2 APN 14 66103724 critical splice donor site probably null
IGL02164:Ephx2 APN 14 66103720 splice site probably benign
IGL02606:Ephx2 APN 14 66086292 missense probably damaging 1.00
PIT4618001:Ephx2 UTSW 14 66102222 missense probably damaging 0.99
R0396:Ephx2 UTSW 14 66108063 missense probably benign 0.03
R0732:Ephx2 UTSW 14 66086963 critical splice donor site probably null
R0762:Ephx2 UTSW 14 66102179 missense probably damaging 1.00
R1444:Ephx2 UTSW 14 66107320 missense probably damaging 1.00
R1689:Ephx2 UTSW 14 66087026 nonsense probably null
R1735:Ephx2 UTSW 14 66088303 missense probably benign
R4210:Ephx2 UTSW 14 66084944 missense probably damaging 1.00
R5130:Ephx2 UTSW 14 66108062 missense probably damaging 0.97
R5800:Ephx2 UTSW 14 66107302 missense probably benign 0.38
R6013:Ephx2 UTSW 14 66110242 missense probably benign 0.19
R6076:Ephx2 UTSW 14 66092848 missense probably damaging 1.00
R6193:Ephx2 UTSW 14 66089512 missense probably benign 0.01
R6193:Ephx2 UTSW 14 66112220 missense probably benign 0.12
R7324:Ephx2 UTSW 14 66085354 missense probably damaging 1.00
R7390:Ephx2 UTSW 14 66110455
R7504:Ephx2 UTSW 14 66101617 missense probably damaging 0.99
R7759:Ephx2 UTSW 14 66089519 missense possibly damaging 0.67
R7814:Ephx2 UTSW 14 66110229 missense probably benign 0.09
R7863:Ephx2 UTSW 14 66107243 nonsense probably null
R7946:Ephx2 UTSW 14 66107243 nonsense probably null
R8003:Ephx2 UTSW 14 66124333 critical splice donor site probably null
R8157:Ephx2 UTSW 14 66108057 missense probably damaging 1.00
RF023:Ephx2 UTSW 14 66084929 critical splice donor site probably null
Z1088:Ephx2 UTSW 14 66107318 missense probably benign 0.00
Z1177:Ephx2 UTSW 14 66085325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCTCTTCTCTGATGGC -3'
(R):5'- GGTATAATTCCCTGGTCACCTG -3'

Sequencing Primer
(F):5'- TGGCACAGGCATACTCAAAAG -3'
(R):5'- GACCTGTGAGCACTACAGGCTTAC -3'
Posted On2014-06-30