Incidental Mutation 'R1871:Cyp2c66'
ID210793
Institutional Source Beutler Lab
Gene Symbol Cyp2c66
Ensembl Gene ENSMUSG00000067229
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms
MMRRC Submission 039893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1871 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39113898-39187072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39163414 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 191 (D191G)
Ref Sequence ENSEMBL: ENSMUSP00000084487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087234] [ENSMUST00000146494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087234
AA Change: D191G

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084487
Gene: ENSMUSG00000067229
AA Change: D191G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146494
SMART Domains Protein: ENSMUSP00000120397
Gene: ENSMUSG00000067229

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1cpt__ 26 55 4e-9 SMART
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 97% (87/90)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
A930009A15Rik A G 10: 115,579,794 probably null Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abce1 G A 8: 79,685,268 Q588* probably null Het
Acads A T 5: 115,117,642 C45S probably damaging Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
Ano4 T A 10: 88,993,027 I517F probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
Blk A T 14: 63,375,915 S381R possibly damaging Het
Capn15 C A 17: 25,964,229 W426L probably damaging Het
Chd6 T C 2: 160,990,256 T999A probably damaging Het
Clca3a2 A G 3: 144,797,637 Y851H probably benign Het
Crp T A 1: 172,698,605 W86R possibly damaging Het
Ctnnal1 G A 4: 56,812,534 L705F probably benign Het
Cyp4f37 A G 17: 32,634,665 D441G probably damaging Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Eef1g A T 19: 8,977,966 D393V possibly damaging Het
Ephx2 A T 14: 66,084,734 I538N probably damaging Het
Fat4 T A 3: 38,981,072 S2958T possibly damaging Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Gm10287 G T 3: 149,224,737 noncoding transcript Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Gm5346 A T 8: 43,625,095 Y697* probably null Het
Gmcl1 T C 6: 86,697,516 D460G probably benign Het
Gpr158 A G 2: 21,815,615 D641G probably damaging Het
Heph C A X: 96,499,084 S561Y probably benign Het
Hgfac A G 5: 35,042,913 *90W probably null Het
Hp1bp3 C G 4: 138,222,186 P65R probably damaging Het
Ighv6-4 T A 12: 114,406,601 Y58F probably benign Het
Jrk T C 15: 74,706,563 D291G possibly damaging Het
Kdm4d A G 9: 14,464,383 Y60H probably damaging Het
Khdrbs3 T C 15: 69,049,442 Y203H probably damaging Het
Klhl6 A T 16: 19,957,043 V255D possibly damaging Het
Krt9 C T 11: 100,190,788 R305H probably damaging Het
Lama2 T G 10: 26,984,494 N2999T probably damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lipa A T 19: 34,510,928 L106Q probably damaging Het
Llph A T 10: 120,231,236 N86I probably damaging Het
Lyst T A 13: 13,651,712 N1601K probably benign Het
Mc1r T A 8: 123,407,536 S9R probably benign Het
Mfsd14a A G 3: 116,641,320 I249T probably benign Het
Mtfp1 G A 11: 4,094,012 R73C probably benign Het
Myo1a A G 10: 127,719,671 Q877R probably benign Het
Nalcn A C 14: 123,594,553 V103G possibly damaging Het
Ndst3 A T 3: 123,562,024 F119I probably damaging Het
Olfr1008 A G 2: 85,690,311 N294S probably damaging Het
Patl1 T C 19: 11,925,232 probably benign Het
Pcdhb2 A T 18: 37,297,355 probably null Het
Pcdhb22 A C 18: 37,519,147 T223P probably damaging Het
Pcdhga1 T A 18: 37,840,090 N907K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Plpp6 T C 19: 28,964,284 F95S probably damaging Het
Polr2b T A 5: 77,326,527 probably benign Het
Qars T G 9: 108,514,116 probably null Het
Ranbp2 A G 10: 58,492,561 I2800V probably damaging Het
Rnf213 T C 11: 119,450,129 V3532A probably benign Het
Rubcnl T C 14: 75,042,409 S411P possibly damaging Het
Scn1a C A 2: 66,318,025 G1059W probably damaging Het
Sgms1 C T 19: 32,159,882 V95I probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Sorl1 G A 9: 41,969,725 Q2167* probably null Het
Stkld1 A G 2: 26,937,973 probably benign Het
Taar8b T C 10: 24,092,002 Y98C probably damaging Het
Tecta G A 9: 42,337,176 L1977F probably damaging Het
Tecta G C 9: 42,337,340 T1917R probably damaging Het
Topaz1 T A 9: 122,799,479 S1544T probably benign Het
Tpx2 T C 2: 152,893,603 I717T probably damaging Het
Tyk2 A T 9: 21,121,441 V342E probably damaging Het
Ube4a A T 9: 44,944,937 probably null Het
Unc80 A T 1: 66,510,717 R711S possibly damaging Het
Ush2a C A 1: 188,826,468 D3631E probably benign Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wif1 A G 10: 121,084,919 I215M probably benign Het
Wnk1 T C 6: 119,951,089 T1134A probably damaging Het
Xxylt1 A G 16: 30,957,417 V367A probably damaging Het
Zfp735 A T 11: 73,710,586 K119* probably null Het
Other mutations in Cyp2c66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Cyp2c66 APN 19 39170961 missense probably benign 0.00
IGL01589:Cyp2c66 APN 19 39183935 critical splice donor site probably null
IGL02098:Cyp2c66 APN 19 39171029 missense probably damaging 1.00
IGL02114:Cyp2c66 APN 19 39171075 splice site probably benign
IGL02567:Cyp2c66 APN 19 39186640 utr 3 prime probably benign
IGL03181:Cyp2c66 APN 19 39142039 missense probably benign 0.00
IGL03230:Cyp2c66 APN 19 39183858 missense possibly damaging 0.91
R0007:Cyp2c66 UTSW 19 39170958 nonsense probably null
R0092:Cyp2c66 UTSW 19 39183780 splice site probably benign
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0242:Cyp2c66 UTSW 19 39141925 missense probably damaging 1.00
R0324:Cyp2c66 UTSW 19 39176691 missense probably benign 0.27
R0675:Cyp2c66 UTSW 19 39186616 missense possibly damaging 0.93
R1127:Cyp2c66 UTSW 19 39163368 missense probably damaging 1.00
R3404:Cyp2c66 UTSW 19 39163327 missense probably benign
R3429:Cyp2c66 UTSW 19 39163448 missense probably damaging 0.97
R3896:Cyp2c66 UTSW 19 39142278 missense possibly damaging 0.82
R4115:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4116:Cyp2c66 UTSW 19 39176559 missense possibly damaging 0.66
R4667:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4668:Cyp2c66 UTSW 19 39176656 missense probably damaging 1.00
R4711:Cyp2c66 UTSW 19 39163399 missense possibly damaging 0.74
R4960:Cyp2c66 UTSW 19 39163322 critical splice acceptor site probably null
R5070:Cyp2c66 UTSW 19 39163470 missense probably benign 0.15
R5113:Cyp2c66 UTSW 19 39163438 missense probably benign 0.00
R5125:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5178:Cyp2c66 UTSW 19 39171029 missense probably damaging 1.00
R5588:Cyp2c66 UTSW 19 39163414 missense possibly damaging 0.66
R6011:Cyp2c66 UTSW 19 39141936 missense probably benign 0.00
R6497:Cyp2c66 UTSW 19 39163377 missense probably damaging 0.96
R6707:Cyp2c66 UTSW 19 39186500 missense probably damaging 1.00
R7173:Cyp2c66 UTSW 19 39170957 missense probably benign 0.01
R7202:Cyp2c66 UTSW 19 39141904 missense probably damaging 1.00
R7469:Cyp2c66 UTSW 19 39183863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGACTTGCTTAAATTGTGACCAG -3'
(R):5'- AATCAGTGAACAGTGTTCTAACAGC -3'

Sequencing Primer
(F):5'- GTGACCAGTTTCTTTATCTGTTGAG -3'
(R):5'- AACAGTGTTCTAACAGCCTTCATTTC -3'
Posted On2014-06-30