Incidental Mutation 'R1872:Kdm5b'
ID210799
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission 039894-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R1872 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134624994 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1236 (L1236P)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
PDB Structure
Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000047714
AA Change: L1236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: L1236P

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112198
AA Change: L1236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: L1236P

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191572
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,844 C133Y unknown Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 A G 8: 79,690,251 M377T possibly damaging Het
Adam25 A T 8: 40,755,226 R510* probably null Het
Adamts12 G T 15: 11,217,880 E308* probably null Het
Adgrg3 C A 8: 95,033,442 N96K possibly damaging Het
Afdn T C 17: 13,881,316 V1022A probably damaging Het
Akap9 T C 5: 4,001,406 V1391A probably damaging Het
Akip1 A G 7: 109,711,775 Y174C probably damaging Het
Ap3b2 T C 7: 81,464,150 T830A unknown Het
Aph1a A G 3: 95,895,564 T159A probably damaging Het
Ccdc146 T C 5: 21,301,290 T718A probably benign Het
Cdk5r2 T C 1: 74,855,822 L242P probably damaging Het
Cep97 T A 16: 55,927,866 N67I probably damaging Het
Chic2 A T 5: 75,011,479 W121R possibly damaging Het
Clock A G 5: 76,248,462 S147P possibly damaging Het
Cntnap5a T G 1: 116,089,210 S178A probably benign Het
Col11a2 C A 17: 34,062,555 probably benign Het
Col6a3 T A 1: 90,830,214 H6L probably damaging Het
Cpne5 T C 17: 29,204,693 N154D probably benign Het
Ctsz T G 2: 174,427,976 K273Q probably benign Het
Cybrd1 G A 2: 71,129,760 V101M probably benign Het
Cyp2c23 T A 19: 44,005,551 K459* probably null Het
Cyp4a31 A T 4: 115,574,736 H419L probably damaging Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dnah9 C T 11: 66,037,490 V2118M probably benign Het
Doxl2 A G 6: 48,975,620 I160V probably benign Het
Dtna T C 18: 23,597,560 probably null Het
Ednra C T 8: 77,720,396 V18I possibly damaging Het
Elac1 T C 18: 73,742,646 R105G probably benign Het
Exoc2 A G 13: 30,822,661 S844P probably benign Het
Fam185a A T 5: 21,480,330 probably null Het
Fam204a A G 19: 60,199,449 M233T possibly damaging Het
Fat1 C A 8: 44,953,304 H1031N probably benign Het
Fat1 T A 8: 45,038,349 Y3816N probably damaging Het
Fbxo38 C T 18: 62,517,023 R621Q probably benign Het
Fhod3 C A 18: 25,130,610 R1524S probably damaging Het
Fnip1 A T 11: 54,487,735 R192W probably damaging Het
Frem3 T A 8: 80,612,576 H499Q probably damaging Het
Gab2 C T 7: 97,299,043 T280I probably damaging Het
Gdpgp1 A G 7: 80,238,424 R68G probably benign Het
Gm10382 C T 5: 125,389,560 probably benign Het
Gm4858 T A 3: 93,074,422 L249H probably damaging Het
Gmps A G 3: 64,001,517 H480R probably benign Het
Hecw1 G A 13: 14,280,449 R674* probably null Het
Herc2 T A 7: 56,157,509 F2478L probably benign Het
Homer2 C T 7: 81,636,402 V21M probably damaging Het
Ifna9 A G 4: 88,592,255 M44T probably damaging Het
Igfl3 A G 7: 18,179,896 D57G possibly damaging Het
Jcad T C 18: 4,673,048 M270T probably benign Het
Kif14 T A 1: 136,486,358 L724Q probably damaging Het
Lhb T C 7: 45,421,333 V45A probably damaging Het
Lhpp A G 7: 132,634,087 N134D probably benign Het
Mas1 T C 17: 12,842,191 Y115C probably damaging Het
Mb21d1 T C 9: 78,433,202 D416G probably benign Het
Mgam A T 6: 40,661,300 K395* probably null Het
Mms22l A G 4: 24,598,807 N1134S probably damaging Het
Mrc1 A G 2: 14,325,381 probably null Het
Mrgprg G A 7: 143,764,544 S277L probably damaging Het
Mrpl49 G T 19: 6,056,980 P60T possibly damaging Het
Mrps10 G A 17: 47,372,452 G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 Y120C probably damaging Het
N4bp2 C T 5: 65,794,518 probably benign Het
Nbea A G 3: 55,642,889 V2706A probably benign Het
Nfic T A 10: 81,420,684 M71L possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1112 A G 2: 87,191,878 T64A possibly damaging Het
Olfr115 G T 17: 37,609,912 P280T probably damaging Het
Olfr1202 T A 2: 88,817,936 V255E probably benign Het
Olfr1234 A G 2: 89,362,589 L280P probably damaging Het
Pak7 T C 2: 136,085,588 I655V possibly damaging Het
Pip5k1c A G 10: 81,306,319 N121S probably damaging Het
Plce1 A T 19: 38,760,077 I1737F probably damaging Het
Prrt1 T C 17: 34,630,951 L113P probably damaging Het
Ptprq T A 10: 107,643,999 T1137S probably benign Het
Recql5 T C 11: 115,923,309 I223V probably benign Het
Reg3g A T 6: 78,467,853 Y47* probably null Het
Rgs12 T G 5: 34,965,821 M316R probably damaging Het
Ric1 T C 19: 29,602,668 S1290P probably benign Het
Rpl36al A G 12: 69,182,923 C72R probably damaging Het
Rplp0 T A 5: 115,563,315 F275L possibly damaging Het
Rpp30 G A 19: 36,087,393 V89I probably benign Het
Ryr3 A G 2: 112,709,137 F3253L possibly damaging Het
Serpina3n A T 12: 104,408,944 N92Y probably benign Het
Setd7 G T 3: 51,542,831 T58N probably benign Het
Sh3tc2 T A 18: 62,011,883 L1136Q probably damaging Het
Slc35b4 G A 6: 34,158,505 Q291* probably null Het
Soga1 A G 2: 157,040,261 C624R possibly damaging Het
Sort1 A G 3: 108,340,695 N452S probably benign Het
Sympk A G 7: 19,029,145 I46V probably benign Het
Syngr2 T C 11: 117,812,538 V60A probably damaging Het
Syt17 A T 7: 118,408,118 F318I probably benign Het
Tgfb1 T A 7: 25,692,466 L149M probably damaging Het
Ticam1 A T 17: 56,271,897 M66K probably benign Het
Tmem131 G T 1: 36,807,927 D1363E probably benign Het
Tns4 A C 11: 99,080,100 D261E probably damaging Het
Trim30a T C 7: 104,429,210 N220D probably benign Het
Trmt10a T C 3: 138,156,720 L257P probably damaging Het
Troap G T 15: 99,075,352 probably benign Het
Ttc6 T C 12: 57,704,552 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vav1 A C 17: 57,324,750 K775T probably damaging Het
Vmn1r236 A G 17: 21,287,411 K264E possibly damaging Het
Vmn1r84 A G 7: 12,362,628 V46A probably benign Het
Wdr59 A T 8: 111,459,017 W835R probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp7 T G 15: 76,891,777 I673S probably benign Het
Zmynd11 A G 13: 9,698,701 I108T possibly damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTGCTTGTGTCAGAAGACTCC -3'
(R):5'- GTATCCCACAAAGTGCAGGC -3'

Sequencing Primer
(F):5'- TTGTGTCAGAAGACTCCAGCCAC -3'
(R):5'- CTGATGCCTGTCCTGCTGAG -3'
Posted On2014-06-30