Incidental Mutation 'R1872:Or4c105'
ID 210806
Institutional Source Beutler Lab
Gene Symbol Or4c105
Ensembl Gene ENSMUSG00000064084
Gene Name olfactory receptor family 4 subfamily C member 105
Synonyms Olfr1202, GA_x6K02T2Q125-50290367-50291296, MOR232-7
MMRRC Submission 039894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R1872 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 88643145-88648446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88648280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 255 (V255E)
Ref Sequence ENSEMBL: ENSMUSP00000150743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057] [ENSMUST00000214703] [ENSMUST00000217059]
AlphaFold Q8VF98
Predicted Effect probably benign
Transcript: ENSMUST00000072057
AA Change: V255E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: V255E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214703
AA Change: V255E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000217059
AA Change: V255E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,350,493 (GRCm39) C133Y unknown Het
Abce1 A G 8: 80,416,880 (GRCm39) M377T possibly damaging Het
Adam25 A T 8: 41,208,263 (GRCm39) R510* probably null Het
Adamts12 G T 15: 11,217,966 (GRCm39) E308* probably null Het
Adgrg3 C A 8: 95,760,070 (GRCm39) N96K possibly damaging Het
Afdn T C 17: 14,101,578 (GRCm39) V1022A probably damaging Het
Akap9 T C 5: 4,051,406 (GRCm39) V1391A probably damaging Het
Akip1 A G 7: 109,310,982 (GRCm39) Y174C probably damaging Het
Aoc1l1 A G 6: 48,952,554 (GRCm39) I160V probably benign Het
Ap3b2 T C 7: 81,113,898 (GRCm39) T830A unknown Het
Aph1a A G 3: 95,802,876 (GRCm39) T159A probably damaging Het
Ccdc146 T C 5: 21,506,288 (GRCm39) T718A probably benign Het
Cdk5r2 T C 1: 74,894,981 (GRCm39) L242P probably damaging Het
Cep97 T A 16: 55,748,229 (GRCm39) N67I probably damaging Het
Cgas T C 9: 78,340,484 (GRCm39) D416G probably benign Het
Chic2 A T 5: 75,172,140 (GRCm39) W121R possibly damaging Het
Clock A G 5: 76,396,309 (GRCm39) S147P possibly damaging Het
Cntnap5a T G 1: 116,016,940 (GRCm39) S178A probably benign Het
Col11a2 C A 17: 34,281,529 (GRCm39) probably benign Het
Col6a3 T A 1: 90,757,936 (GRCm39) H6L probably damaging Het
Cpne5 T C 17: 29,423,667 (GRCm39) N154D probably benign Het
Ctsz T G 2: 174,269,769 (GRCm39) K273Q probably benign Het
Cybrd1 G A 2: 70,960,104 (GRCm39) V101M probably benign Het
Cyp2c23 T A 19: 43,993,990 (GRCm39) K459* probably null Het
Cyp4a31 A T 4: 115,431,933 (GRCm39) H419L probably damaging Het
D930020B18Rik G A 10: 121,477,879 (GRCm39) V35M probably damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dnah9 C T 11: 65,928,316 (GRCm39) V2118M probably benign Het
Dtna T C 18: 23,730,617 (GRCm39) probably null Het
Ednra C T 8: 78,447,025 (GRCm39) V18I possibly damaging Het
Elac1 T C 18: 73,875,717 (GRCm39) R105G probably benign Het
Exoc2 A G 13: 31,006,644 (GRCm39) S844P probably benign Het
Fam185a A T 5: 21,685,328 (GRCm39) probably null Het
Fam204a A G 19: 60,187,881 (GRCm39) M233T possibly damaging Het
Fat1 C A 8: 45,406,341 (GRCm39) H1031N probably benign Het
Fat1 T A 8: 45,491,386 (GRCm39) Y3816N probably damaging Het
Fbxo38 C T 18: 62,650,094 (GRCm39) R621Q probably benign Het
Fhod3 C A 18: 25,263,667 (GRCm39) R1524S probably damaging Het
Fnip1 A T 11: 54,378,561 (GRCm39) R192W probably damaging Het
Frem3 T A 8: 81,339,205 (GRCm39) H499Q probably damaging Het
Gab2 C T 7: 96,948,250 (GRCm39) T280I probably damaging Het
Gdpgp1 A G 7: 79,888,172 (GRCm39) R68G probably benign Het
Gm10382 C T 5: 125,466,624 (GRCm39) probably benign Het
Gmps A G 3: 63,908,938 (GRCm39) H480R probably benign Het
Hecw1 G A 13: 14,455,034 (GRCm39) R674* probably null Het
Herc2 T A 7: 55,807,257 (GRCm39) F2478L probably benign Het
Homer2 C T 7: 81,286,150 (GRCm39) V21M probably damaging Het
Ifna9 A G 4: 88,510,492 (GRCm39) M44T probably damaging Het
Igfl3 A G 7: 17,913,821 (GRCm39) D57G possibly damaging Het
Jcad T C 18: 4,673,048 (GRCm39) M270T probably benign Het
Kdm5b T C 1: 134,552,732 (GRCm39) L1236P probably damaging Het
Kif14 T A 1: 136,414,096 (GRCm39) L724Q probably damaging Het
Lhb T C 7: 45,070,757 (GRCm39) V45A probably damaging Het
Lhpp A G 7: 132,235,816 (GRCm39) N134D probably benign Het
Mas1 T C 17: 13,061,078 (GRCm39) Y115C probably damaging Het
Mgam A T 6: 40,638,234 (GRCm39) K395* probably null Het
Mms22l A G 4: 24,598,807 (GRCm39) N1134S probably damaging Het
Mrc1 A G 2: 14,330,192 (GRCm39) probably null Het
Mrgprg G A 7: 143,318,281 (GRCm39) S277L probably damaging Het
Mrpl49 G T 19: 6,107,010 (GRCm39) P60T possibly damaging Het
Mrps10 G A 17: 47,683,377 (GRCm39) G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 (GRCm39) Y120C probably damaging Het
Mtcl2 A G 2: 156,882,181 (GRCm39) C624R possibly damaging Het
N4bp2 C T 5: 65,951,861 (GRCm39) probably benign Het
Nbea A G 3: 55,550,310 (GRCm39) V2706A probably benign Het
Nfic T A 10: 81,256,518 (GRCm39) M71L possibly damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or12e1 A G 2: 87,022,222 (GRCm39) T64A possibly damaging Het
Or14j4 G T 17: 37,920,803 (GRCm39) P280T probably damaging Het
Or4a15 A G 2: 89,192,933 (GRCm39) L280P probably damaging Het
Pak5 T C 2: 135,927,508 (GRCm39) I655V possibly damaging Het
Pip5k1c A G 10: 81,142,153 (GRCm39) N121S probably damaging Het
Plce1 A T 19: 38,748,521 (GRCm39) I1737F probably damaging Het
Prrt1 T C 17: 34,849,925 (GRCm39) L113P probably damaging Het
Ptprq T A 10: 107,479,860 (GRCm39) T1137S probably benign Het
Recql5 T C 11: 115,814,135 (GRCm39) I223V probably benign Het
Reg3g A T 6: 78,444,836 (GRCm39) Y47* probably null Het
Rgs12 T G 5: 35,123,165 (GRCm39) M316R probably damaging Het
Ric1 T C 19: 29,580,068 (GRCm39) S1290P probably benign Het
Rpl36al A G 12: 69,229,697 (GRCm39) C72R probably damaging Het
Rplp0 T A 5: 115,701,374 (GRCm39) F275L possibly damaging Het
Rpp30 G A 19: 36,064,793 (GRCm39) V89I probably benign Het
Ryr3 A G 2: 112,539,482 (GRCm39) F3253L possibly damaging Het
Serpina3n A T 12: 104,375,203 (GRCm39) N92Y probably benign Het
Setd7 G T 3: 51,450,252 (GRCm39) T58N probably benign Het
Sh3tc2 T A 18: 62,144,954 (GRCm39) L1136Q probably damaging Het
Slc35b4 G A 6: 34,135,440 (GRCm39) Q291* probably null Het
Sort1 A G 3: 108,248,011 (GRCm39) N452S probably benign Het
Sympk A G 7: 18,763,070 (GRCm39) I46V probably benign Het
Syngr2 T C 11: 117,703,364 (GRCm39) V60A probably damaging Het
Syt17 A T 7: 118,007,341 (GRCm39) F318I probably benign Het
Tdpoz8 T A 3: 92,981,729 (GRCm39) L249H probably damaging Het
Tgfb1 T A 7: 25,391,891 (GRCm39) L149M probably damaging Het
Ticam1 A T 17: 56,578,897 (GRCm39) M66K probably benign Het
Tmem131 G T 1: 36,847,008 (GRCm39) D1363E probably benign Het
Tns4 A C 11: 98,970,926 (GRCm39) D261E probably damaging Het
Trim30a T C 7: 104,078,417 (GRCm39) N220D probably benign Het
Trmt10a T C 3: 137,862,481 (GRCm39) L257P probably damaging Het
Troap G T 15: 98,973,233 (GRCm39) probably benign Het
Ttc6 T C 12: 57,751,338 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vav1 A C 17: 57,631,750 (GRCm39) K775T probably damaging Het
Vmn1r236 A G 17: 21,507,673 (GRCm39) K264E possibly damaging Het
Vmn1r84 A G 7: 12,096,555 (GRCm39) V46A probably benign Het
Wdr59 A T 8: 112,185,649 (GRCm39) W835R probably damaging Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Zfp7 T G 15: 76,775,977 (GRCm39) I673S probably benign Het
Zmynd11 A G 13: 9,748,737 (GRCm39) I108T possibly damaging Het
Other mutations in Or4c105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Or4c105 APN 2 88,647,781 (GRCm39) missense possibly damaging 0.54
R0105:Or4c105 UTSW 2 88,648,253 (GRCm39) missense probably damaging 1.00
R0699:Or4c105 UTSW 2 88,647,568 (GRCm39) missense probably damaging 1.00
R0709:Or4c105 UTSW 2 88,648,226 (GRCm39) missense probably benign 0.42
R1177:Or4c105 UTSW 2 88,647,704 (GRCm39) missense probably benign 0.06
R1436:Or4c105 UTSW 2 88,648,336 (GRCm39) missense possibly damaging 0.48
R1827:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1828:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1878:Or4c105 UTSW 2 88,647,805 (GRCm39) missense probably benign 0.00
R4903:Or4c105 UTSW 2 88,648,342 (GRCm39) missense probably benign 0.14
R5035:Or4c105 UTSW 2 88,648,443 (GRCm39) missense probably benign 0.01
R6279:Or4c105 UTSW 2 88,647,719 (GRCm39) missense probably damaging 1.00
R7402:Or4c105 UTSW 2 88,647,687 (GRCm39) missense probably damaging 1.00
R7809:Or4c105 UTSW 2 88,647,902 (GRCm39) missense probably damaging 0.96
R8172:Or4c105 UTSW 2 88,647,986 (GRCm39) missense probably damaging 1.00
R8193:Or4c105 UTSW 2 88,647,803 (GRCm39) missense probably damaging 1.00
R8673:Or4c105 UTSW 2 88,647,590 (GRCm39) missense probably benign
R8730:Or4c105 UTSW 2 88,648,043 (GRCm39) missense possibly damaging 0.64
R9459:Or4c105 UTSW 2 88,647,967 (GRCm39) missense probably benign 0.12
R9772:Or4c105 UTSW 2 88,647,958 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGTATTGACACCCACATC -3'
(R):5'- ATCTGAAGACACATGACTGTTCC -3'

Sequencing Primer
(F):5'- CCACATCCTGGGGCTTTTTG -3'
(R):5'- AGACACATGACTGTTCCTTTATTTG -3'
Posted On 2014-06-30