Incidental Mutation 'R1872:Nbea'
ID210813
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Nameneurobeachin
Synonyms
MMRRC Submission 039894-MU
Accession Numbers

Genbank: NM_030595

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1872 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location55625195-56183701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55642889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2706 (V2706A)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
Predicted Effect probably benign
Transcript: ENSMUST00000029374
AA Change: V2706A

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: V2706A

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199803
Meta Mutation Damage Score 0.3772 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,844 C133Y unknown Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 A G 8: 79,690,251 M377T possibly damaging Het
Adam25 A T 8: 40,755,226 R510* probably null Het
Adamts12 G T 15: 11,217,880 E308* probably null Het
Adgrg3 C A 8: 95,033,442 N96K possibly damaging Het
Afdn T C 17: 13,881,316 V1022A probably damaging Het
Akap9 T C 5: 4,001,406 V1391A probably damaging Het
Akip1 A G 7: 109,711,775 Y174C probably damaging Het
Ap3b2 T C 7: 81,464,150 T830A unknown Het
Aph1a A G 3: 95,895,564 T159A probably damaging Het
Ccdc146 T C 5: 21,301,290 T718A probably benign Het
Cdk5r2 T C 1: 74,855,822 L242P probably damaging Het
Cep97 T A 16: 55,927,866 N67I probably damaging Het
Chic2 A T 5: 75,011,479 W121R possibly damaging Het
Clock A G 5: 76,248,462 S147P possibly damaging Het
Cntnap5a T G 1: 116,089,210 S178A probably benign Het
Col11a2 C A 17: 34,062,555 probably benign Het
Col6a3 T A 1: 90,830,214 H6L probably damaging Het
Cpne5 T C 17: 29,204,693 N154D probably benign Het
Ctsz T G 2: 174,427,976 K273Q probably benign Het
Cybrd1 G A 2: 71,129,760 V101M probably benign Het
Cyp2c23 T A 19: 44,005,551 K459* probably null Het
Cyp4a31 A T 4: 115,574,736 H419L probably damaging Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dnah9 C T 11: 66,037,490 V2118M probably benign Het
Doxl2 A G 6: 48,975,620 I160V probably benign Het
Dtna T C 18: 23,597,560 probably null Het
Ednra C T 8: 77,720,396 V18I possibly damaging Het
Elac1 T C 18: 73,742,646 R105G probably benign Het
Exoc2 A G 13: 30,822,661 S844P probably benign Het
Fam185a A T 5: 21,480,330 probably null Het
Fam204a A G 19: 60,199,449 M233T possibly damaging Het
Fat1 C A 8: 44,953,304 H1031N probably benign Het
Fat1 T A 8: 45,038,349 Y3816N probably damaging Het
Fbxo38 C T 18: 62,517,023 R621Q probably benign Het
Fhod3 C A 18: 25,130,610 R1524S probably damaging Het
Fnip1 A T 11: 54,487,735 R192W probably damaging Het
Frem3 T A 8: 80,612,576 H499Q probably damaging Het
Gab2 C T 7: 97,299,043 T280I probably damaging Het
Gdpgp1 A G 7: 80,238,424 R68G probably benign Het
Gm10382 C T 5: 125,389,560 probably benign Het
Gm4858 T A 3: 93,074,422 L249H probably damaging Het
Gmps A G 3: 64,001,517 H480R probably benign Het
Hecw1 G A 13: 14,280,449 R674* probably null Het
Herc2 T A 7: 56,157,509 F2478L probably benign Het
Homer2 C T 7: 81,636,402 V21M probably damaging Het
Ifna9 A G 4: 88,592,255 M44T probably damaging Het
Igfl3 A G 7: 18,179,896 D57G possibly damaging Het
Jcad T C 18: 4,673,048 M270T probably benign Het
Kdm5b T C 1: 134,624,994 L1236P probably damaging Het
Kif14 T A 1: 136,486,358 L724Q probably damaging Het
Lhb T C 7: 45,421,333 V45A probably damaging Het
Lhpp A G 7: 132,634,087 N134D probably benign Het
Mas1 T C 17: 12,842,191 Y115C probably damaging Het
Mb21d1 T C 9: 78,433,202 D416G probably benign Het
Mgam A T 6: 40,661,300 K395* probably null Het
Mms22l A G 4: 24,598,807 N1134S probably damaging Het
Mrc1 A G 2: 14,325,381 probably null Het
Mrgprg G A 7: 143,764,544 S277L probably damaging Het
Mrpl49 G T 19: 6,056,980 P60T possibly damaging Het
Mrps10 G A 17: 47,372,452 G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 Y120C probably damaging Het
N4bp2 C T 5: 65,794,518 probably benign Het
Nfic T A 10: 81,420,684 M71L possibly damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1112 A G 2: 87,191,878 T64A possibly damaging Het
Olfr115 G T 17: 37,609,912 P280T probably damaging Het
Olfr1202 T A 2: 88,817,936 V255E probably benign Het
Olfr1234 A G 2: 89,362,589 L280P probably damaging Het
Pak7 T C 2: 136,085,588 I655V possibly damaging Het
Pip5k1c A G 10: 81,306,319 N121S probably damaging Het
Plce1 A T 19: 38,760,077 I1737F probably damaging Het
Prrt1 T C 17: 34,630,951 L113P probably damaging Het
Ptprq T A 10: 107,643,999 T1137S probably benign Het
Recql5 T C 11: 115,923,309 I223V probably benign Het
Reg3g A T 6: 78,467,853 Y47* probably null Het
Rgs12 T G 5: 34,965,821 M316R probably damaging Het
Ric1 T C 19: 29,602,668 S1290P probably benign Het
Rpl36al A G 12: 69,182,923 C72R probably damaging Het
Rplp0 T A 5: 115,563,315 F275L possibly damaging Het
Rpp30 G A 19: 36,087,393 V89I probably benign Het
Ryr3 A G 2: 112,709,137 F3253L possibly damaging Het
Serpina3n A T 12: 104,408,944 N92Y probably benign Het
Setd7 G T 3: 51,542,831 T58N probably benign Het
Sh3tc2 T A 18: 62,011,883 L1136Q probably damaging Het
Slc35b4 G A 6: 34,158,505 Q291* probably null Het
Soga1 A G 2: 157,040,261 C624R possibly damaging Het
Sort1 A G 3: 108,340,695 N452S probably benign Het
Sympk A G 7: 19,029,145 I46V probably benign Het
Syngr2 T C 11: 117,812,538 V60A probably damaging Het
Syt17 A T 7: 118,408,118 F318I probably benign Het
Tgfb1 T A 7: 25,692,466 L149M probably damaging Het
Ticam1 A T 17: 56,271,897 M66K probably benign Het
Tmem131 G T 1: 36,807,927 D1363E probably benign Het
Tns4 A C 11: 99,080,100 D261E probably damaging Het
Trim30a T C 7: 104,429,210 N220D probably benign Het
Trmt10a T C 3: 138,156,720 L257P probably damaging Het
Troap G T 15: 99,075,352 probably benign Het
Ttc6 T C 12: 57,704,552 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vav1 A C 17: 57,324,750 K775T probably damaging Het
Vmn1r236 A G 17: 21,287,411 K264E possibly damaging Het
Vmn1r84 A G 7: 12,362,628 V46A probably benign Het
Wdr59 A T 8: 111,459,017 W835R probably damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp7 T G 15: 76,891,777 I673S probably benign Het
Zmynd11 A G 13: 9,698,701 I108T possibly damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2097:Nbea UTSW 3 55723217 missense probably damaging 0.96
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4758:Nbea UTSW 3 56005403 missense probably benign
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6488:Nbea UTSW 3 55717843 missense probably damaging 0.99
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7916:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7932:Nbea UTSW 3 55990875 intron probably null
R7968:Nbea UTSW 3 55665689 missense probably damaging 0.97
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
R8290:Nbea UTSW 3 56058635 nonsense probably null
R8314:Nbea UTSW 3 56009251 missense probably damaging 0.99
R8321:Nbea UTSW 3 56183097 missense possibly damaging 0.86
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTCTGAAAGGACCCTTGTGG -3'
(R):5'- CTGTCAGGCCCAAATTCTGAAGAG -3'

Sequencing Primer
(F):5'- GGAGACACTTACTGCTATTGGG -3'
(R):5'- GAAAAATCATGGCCATCTCGTAAG -3'
Posted On2014-06-30