Incidental Mutation 'R1872:Mgam'
ID 210834
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission 039894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R1872 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 40605765-40746057 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 40638234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 395 (K395*)
Ref Sequence ENSEMBL: ENSMUSP00000143946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202636]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000071535
AA Change: K395*
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: K395*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201148
AA Change: K395*
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: K395*

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202636
SMART Domains Protein: ENSMUSP00000144652
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Trefoil 28 70 3.6e-12 PFAM
Pfam:NtCtMGAM_N 87 196 1.4e-36 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,350,493 (GRCm39) C133Y unknown Het
Abce1 A G 8: 80,416,880 (GRCm39) M377T possibly damaging Het
Adam25 A T 8: 41,208,263 (GRCm39) R510* probably null Het
Adamts12 G T 15: 11,217,966 (GRCm39) E308* probably null Het
Adgrg3 C A 8: 95,760,070 (GRCm39) N96K possibly damaging Het
Afdn T C 17: 14,101,578 (GRCm39) V1022A probably damaging Het
Akap9 T C 5: 4,051,406 (GRCm39) V1391A probably damaging Het
Akip1 A G 7: 109,310,982 (GRCm39) Y174C probably damaging Het
Aoc1l1 A G 6: 48,952,554 (GRCm39) I160V probably benign Het
Ap3b2 T C 7: 81,113,898 (GRCm39) T830A unknown Het
Aph1a A G 3: 95,802,876 (GRCm39) T159A probably damaging Het
Ccdc146 T C 5: 21,506,288 (GRCm39) T718A probably benign Het
Cdk5r2 T C 1: 74,894,981 (GRCm39) L242P probably damaging Het
Cep97 T A 16: 55,748,229 (GRCm39) N67I probably damaging Het
Cgas T C 9: 78,340,484 (GRCm39) D416G probably benign Het
Chic2 A T 5: 75,172,140 (GRCm39) W121R possibly damaging Het
Clock A G 5: 76,396,309 (GRCm39) S147P possibly damaging Het
Cntnap5a T G 1: 116,016,940 (GRCm39) S178A probably benign Het
Col11a2 C A 17: 34,281,529 (GRCm39) probably benign Het
Col6a3 T A 1: 90,757,936 (GRCm39) H6L probably damaging Het
Cpne5 T C 17: 29,423,667 (GRCm39) N154D probably benign Het
Ctsz T G 2: 174,269,769 (GRCm39) K273Q probably benign Het
Cybrd1 G A 2: 70,960,104 (GRCm39) V101M probably benign Het
Cyp2c23 T A 19: 43,993,990 (GRCm39) K459* probably null Het
Cyp4a31 A T 4: 115,431,933 (GRCm39) H419L probably damaging Het
D930020B18Rik G A 10: 121,477,879 (GRCm39) V35M probably damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dnah9 C T 11: 65,928,316 (GRCm39) V2118M probably benign Het
Dtna T C 18: 23,730,617 (GRCm39) probably null Het
Ednra C T 8: 78,447,025 (GRCm39) V18I possibly damaging Het
Elac1 T C 18: 73,875,717 (GRCm39) R105G probably benign Het
Exoc2 A G 13: 31,006,644 (GRCm39) S844P probably benign Het
Fam185a A T 5: 21,685,328 (GRCm39) probably null Het
Fam204a A G 19: 60,187,881 (GRCm39) M233T possibly damaging Het
Fat1 C A 8: 45,406,341 (GRCm39) H1031N probably benign Het
Fat1 T A 8: 45,491,386 (GRCm39) Y3816N probably damaging Het
Fbxo38 C T 18: 62,650,094 (GRCm39) R621Q probably benign Het
Fhod3 C A 18: 25,263,667 (GRCm39) R1524S probably damaging Het
Fnip1 A T 11: 54,378,561 (GRCm39) R192W probably damaging Het
Frem3 T A 8: 81,339,205 (GRCm39) H499Q probably damaging Het
Gab2 C T 7: 96,948,250 (GRCm39) T280I probably damaging Het
Gdpgp1 A G 7: 79,888,172 (GRCm39) R68G probably benign Het
Gm10382 C T 5: 125,466,624 (GRCm39) probably benign Het
Gmps A G 3: 63,908,938 (GRCm39) H480R probably benign Het
Hecw1 G A 13: 14,455,034 (GRCm39) R674* probably null Het
Herc2 T A 7: 55,807,257 (GRCm39) F2478L probably benign Het
Homer2 C T 7: 81,286,150 (GRCm39) V21M probably damaging Het
Ifna9 A G 4: 88,510,492 (GRCm39) M44T probably damaging Het
Igfl3 A G 7: 17,913,821 (GRCm39) D57G possibly damaging Het
Jcad T C 18: 4,673,048 (GRCm39) M270T probably benign Het
Kdm5b T C 1: 134,552,732 (GRCm39) L1236P probably damaging Het
Kif14 T A 1: 136,414,096 (GRCm39) L724Q probably damaging Het
Lhb T C 7: 45,070,757 (GRCm39) V45A probably damaging Het
Lhpp A G 7: 132,235,816 (GRCm39) N134D probably benign Het
Mas1 T C 17: 13,061,078 (GRCm39) Y115C probably damaging Het
Mms22l A G 4: 24,598,807 (GRCm39) N1134S probably damaging Het
Mrc1 A G 2: 14,330,192 (GRCm39) probably null Het
Mrgprg G A 7: 143,318,281 (GRCm39) S277L probably damaging Het
Mrpl49 G T 19: 6,107,010 (GRCm39) P60T possibly damaging Het
Mrps10 G A 17: 47,683,377 (GRCm39) G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 (GRCm39) Y120C probably damaging Het
Mtcl2 A G 2: 156,882,181 (GRCm39) C624R possibly damaging Het
N4bp2 C T 5: 65,951,861 (GRCm39) probably benign Het
Nbea A G 3: 55,550,310 (GRCm39) V2706A probably benign Het
Nfic T A 10: 81,256,518 (GRCm39) M71L possibly damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or12e1 A G 2: 87,022,222 (GRCm39) T64A possibly damaging Het
Or14j4 G T 17: 37,920,803 (GRCm39) P280T probably damaging Het
Or4a15 A G 2: 89,192,933 (GRCm39) L280P probably damaging Het
Or4c105 T A 2: 88,648,280 (GRCm39) V255E probably benign Het
Pak5 T C 2: 135,927,508 (GRCm39) I655V possibly damaging Het
Pip5k1c A G 10: 81,142,153 (GRCm39) N121S probably damaging Het
Plce1 A T 19: 38,748,521 (GRCm39) I1737F probably damaging Het
Prrt1 T C 17: 34,849,925 (GRCm39) L113P probably damaging Het
Ptprq T A 10: 107,479,860 (GRCm39) T1137S probably benign Het
Recql5 T C 11: 115,814,135 (GRCm39) I223V probably benign Het
Reg3g A T 6: 78,444,836 (GRCm39) Y47* probably null Het
Rgs12 T G 5: 35,123,165 (GRCm39) M316R probably damaging Het
Ric1 T C 19: 29,580,068 (GRCm39) S1290P probably benign Het
Rpl36al A G 12: 69,229,697 (GRCm39) C72R probably damaging Het
Rplp0 T A 5: 115,701,374 (GRCm39) F275L possibly damaging Het
Rpp30 G A 19: 36,064,793 (GRCm39) V89I probably benign Het
Ryr3 A G 2: 112,539,482 (GRCm39) F3253L possibly damaging Het
Serpina3n A T 12: 104,375,203 (GRCm39) N92Y probably benign Het
Setd7 G T 3: 51,450,252 (GRCm39) T58N probably benign Het
Sh3tc2 T A 18: 62,144,954 (GRCm39) L1136Q probably damaging Het
Slc35b4 G A 6: 34,135,440 (GRCm39) Q291* probably null Het
Sort1 A G 3: 108,248,011 (GRCm39) N452S probably benign Het
Sympk A G 7: 18,763,070 (GRCm39) I46V probably benign Het
Syngr2 T C 11: 117,703,364 (GRCm39) V60A probably damaging Het
Syt17 A T 7: 118,007,341 (GRCm39) F318I probably benign Het
Tdpoz8 T A 3: 92,981,729 (GRCm39) L249H probably damaging Het
Tgfb1 T A 7: 25,391,891 (GRCm39) L149M probably damaging Het
Ticam1 A T 17: 56,578,897 (GRCm39) M66K probably benign Het
Tmem131 G T 1: 36,847,008 (GRCm39) D1363E probably benign Het
Tns4 A C 11: 98,970,926 (GRCm39) D261E probably damaging Het
Trim30a T C 7: 104,078,417 (GRCm39) N220D probably benign Het
Trmt10a T C 3: 137,862,481 (GRCm39) L257P probably damaging Het
Troap G T 15: 98,973,233 (GRCm39) probably benign Het
Ttc6 T C 12: 57,751,338 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vav1 A C 17: 57,631,750 (GRCm39) K775T probably damaging Het
Vmn1r236 A G 17: 21,507,673 (GRCm39) K264E possibly damaging Het
Vmn1r84 A G 7: 12,096,555 (GRCm39) V46A probably benign Het
Wdr59 A T 8: 112,185,649 (GRCm39) W835R probably damaging Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Zfp7 T G 15: 76,775,977 (GRCm39) I673S probably benign Het
Zmynd11 A G 13: 9,748,737 (GRCm39) I108T possibly damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40,619,944 (GRCm39) missense probably benign
IGL01065:Mgam APN 6 40,639,644 (GRCm39) critical splice donor site probably null
IGL01402:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01404:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01413:Mgam APN 6 40,638,211 (GRCm39) missense probably damaging 1.00
IGL01546:Mgam APN 6 40,631,627 (GRCm39) missense probably damaging 0.98
IGL01596:Mgam APN 6 40,635,204 (GRCm39) missense probably damaging 1.00
IGL02133:Mgam APN 6 40,620,010 (GRCm39) missense probably damaging 0.98
IGL02734:Mgam APN 6 40,639,628 (GRCm39) missense probably damaging 1.00
BB002:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
BB012:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R0012:Mgam UTSW 6 40,742,190 (GRCm39) splice site probably null
R0116:Mgam UTSW 6 40,635,921 (GRCm39) missense probably damaging 1.00
R0310:Mgam UTSW 6 40,737,969 (GRCm39) splice site probably benign
R0452:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
R0497:Mgam UTSW 6 40,641,826 (GRCm39) missense probably damaging 1.00
R0699:Mgam UTSW 6 40,619,953 (GRCm39) missense possibly damaging 0.84
R0738:Mgam UTSW 6 40,731,869 (GRCm39) missense probably benign 0.01
R1033:Mgam UTSW 6 40,657,558 (GRCm39) missense probably benign 0.07
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1430:Mgam UTSW 6 40,733,305 (GRCm39) missense probably benign 0.08
R1432:Mgam UTSW 6 40,733,301 (GRCm39) missense probably damaging 1.00
R1443:Mgam UTSW 6 40,736,714 (GRCm39) nonsense probably null
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1519:Mgam UTSW 6 40,638,617 (GRCm39) missense probably benign 0.45
R1654:Mgam UTSW 6 40,734,421 (GRCm39) missense probably damaging 1.00
R1667:Mgam UTSW 6 40,653,978 (GRCm39) missense possibly damaging 0.62
R1730:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1781:Mgam UTSW 6 40,646,797 (GRCm39) missense probably damaging 1.00
R1783:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1829:Mgam UTSW 6 40,643,826 (GRCm39) missense probably damaging 1.00
R1833:Mgam UTSW 6 40,631,652 (GRCm39) critical splice donor site probably null
R1912:Mgam UTSW 6 40,741,119 (GRCm39) nonsense probably null
R1977:Mgam UTSW 6 40,641,814 (GRCm39) missense probably benign 0.01
R2048:Mgam UTSW 6 40,633,363 (GRCm39) missense possibly damaging 0.80
R2086:Mgam UTSW 6 40,737,962 (GRCm39) splice site probably null
R2138:Mgam UTSW 6 40,733,384 (GRCm39) missense probably damaging 1.00
R2224:Mgam UTSW 6 40,741,208 (GRCm39) splice site probably null
R2408:Mgam UTSW 6 40,663,456 (GRCm39) missense probably damaging 1.00
R2508:Mgam UTSW 6 40,736,717 (GRCm39) missense probably damaging 1.00
R2842:Mgam UTSW 6 40,638,279 (GRCm39) missense probably benign 0.01
R2847:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2848:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2965:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R2966:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R3035:Mgam UTSW 6 40,640,464 (GRCm39) missense probably benign
R3895:Mgam UTSW 6 40,736,054 (GRCm39) missense probably damaging 1.00
R4027:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4030:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4302:Mgam UTSW 6 40,740,019 (GRCm39) missense probably benign 0.02
R4707:Mgam UTSW 6 40,691,566 (GRCm39) splice site probably null
R4826:Mgam UTSW 6 40,657,582 (GRCm39) missense possibly damaging 0.52
R4898:Mgam UTSW 6 40,619,988 (GRCm39) missense probably benign
R5438:Mgam UTSW 6 40,661,455 (GRCm39) missense probably damaging 1.00
R5492:Mgam UTSW 6 40,733,297 (GRCm39) missense probably damaging 1.00
R5770:Mgam UTSW 6 40,646,738 (GRCm39) missense probably benign 0.01
R5839:Mgam UTSW 6 40,716,998 (GRCm39) missense possibly damaging 0.90
R5845:Mgam UTSW 6 40,652,257 (GRCm39) missense possibly damaging 0.78
R5847:Mgam UTSW 6 40,660,989 (GRCm39) missense probably benign 0.42
R5891:Mgam UTSW 6 40,721,282 (GRCm39) missense probably benign
R6158:Mgam UTSW 6 40,734,648 (GRCm39) missense probably damaging 1.00
R6193:Mgam UTSW 6 40,724,854 (GRCm39) nonsense probably null
R6423:Mgam UTSW 6 40,653,979 (GRCm39) missense possibly damaging 0.84
R6706:Mgam UTSW 6 40,721,720 (GRCm39) missense probably benign 0.00
R6813:Mgam UTSW 6 40,727,099 (GRCm39) missense probably damaging 0.99
R6863:Mgam UTSW 6 40,705,943 (GRCm39) missense probably benign 0.00
R6906:Mgam UTSW 6 40,724,853 (GRCm39) missense probably damaging 1.00
R7091:Mgam UTSW 6 40,745,210 (GRCm39) missense possibly damaging 0.95
R7099:Mgam UTSW 6 40,638,650 (GRCm39) missense probably benign 0.09
R7282:Mgam UTSW 6 40,740,045 (GRCm39) missense probably benign
R7282:Mgam UTSW 6 40,633,446 (GRCm39) missense possibly damaging 0.71
R7354:Mgam UTSW 6 40,721,732 (GRCm39) missense probably damaging 1.00
R7374:Mgam UTSW 6 40,734,373 (GRCm39) missense possibly damaging 0.89
R7399:Mgam UTSW 6 40,643,788 (GRCm39) missense probably damaging 0.99
R7406:Mgam UTSW 6 40,640,459 (GRCm39) missense probably benign 0.13
R7446:Mgam UTSW 6 40,723,266 (GRCm39) missense probably damaging 1.00
R7466:Mgam UTSW 6 40,721,723 (GRCm39) missense probably benign 0.00
R7525:Mgam UTSW 6 40,742,954 (GRCm39) missense probably benign 0.01
R7530:Mgam UTSW 6 40,686,152 (GRCm39) splice site probably null
R7570:Mgam UTSW 6 40,723,367 (GRCm39) missense probably benign 0.16
R7669:Mgam UTSW 6 40,635,944 (GRCm39) missense probably benign 0.00
R7679:Mgam UTSW 6 40,619,980 (GRCm39) missense probably damaging 0.98
R7746:Mgam UTSW 6 40,645,127 (GRCm39) missense probably damaging 0.99
R7859:Mgam UTSW 6 40,717,113 (GRCm39) missense possibly damaging 0.75
R7925:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R8206:Mgam UTSW 6 40,657,169 (GRCm39) missense probably benign 0.00
R8244:Mgam UTSW 6 40,727,520 (GRCm39) missense probably damaging 1.00
R8309:Mgam UTSW 6 40,722,111 (GRCm39) missense possibly damaging 0.88
R8472:Mgam UTSW 6 40,671,460 (GRCm39) splice site probably null
R8758:Mgam UTSW 6 40,705,977 (GRCm39) missense probably benign 0.41
R8777:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8783:Mgam UTSW 6 40,633,423 (GRCm39) missense probably damaging 0.99
R8939:Mgam UTSW 6 40,740,137 (GRCm39) critical splice donor site probably null
R8968:Mgam UTSW 6 40,734,745 (GRCm39) critical splice acceptor site probably null
R8987:Mgam UTSW 6 40,706,570 (GRCm39) missense probably damaging 1.00
R9055:Mgam UTSW 6 40,691,663 (GRCm39) intron probably benign
R9171:Mgam UTSW 6 40,745,146 (GRCm39) missense possibly damaging 0.76
R9252:Mgam UTSW 6 40,706,577 (GRCm39) missense probably damaging 0.99
R9258:Mgam UTSW 6 40,657,121 (GRCm39) missense probably benign
R9262:Mgam UTSW 6 40,723,422 (GRCm39) critical splice donor site probably null
R9287:Mgam UTSW 6 40,705,905 (GRCm39) intron probably benign
R9521:Mgam UTSW 6 40,722,118 (GRCm39) missense probably damaging 1.00
R9589:Mgam UTSW 6 40,727,519 (GRCm39) missense probably damaging 1.00
R9658:Mgam UTSW 6 40,721,311 (GRCm39) missense possibly damaging 0.93
R9784:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
RF011:Mgam UTSW 6 40,734,370 (GRCm39) missense probably damaging 1.00
RF020:Mgam UTSW 6 40,662,243 (GRCm39) missense probably damaging 1.00
RF023:Mgam UTSW 6 40,657,642 (GRCm39) missense probably benign
X0021:Mgam UTSW 6 40,635,981 (GRCm39) missense probably damaging 1.00
Z1088:Mgam UTSW 6 40,619,994 (GRCm39) missense probably benign 0.01
Z1176:Mgam UTSW 6 40,706,000 (GRCm39) missense probably damaging 1.00
Z1176:Mgam UTSW 6 40,654,578 (GRCm39) critical splice donor site probably null
Z1177:Mgam UTSW 6 40,717,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATTCATTTCTTAAACCGC -3'
(R):5'- TCATTTATTTGGATGCCAAGGAGG -3'

Sequencing Primer
(F):5'- GTGCATTTGGATAGCACAGACTC -3'
(R):5'- TTATTTGGATGCCAAGGAGGAAGAAG -3'
Posted On 2014-06-30