Incidental Mutation 'R1872:Ap3b2'
ID 210846
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 039894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R1872 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81113898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 830 (T830A)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090]
AlphaFold Q9JME5
Predicted Effect unknown
Transcript: ENSMUST00000082090
AA Change: T830A
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: T830A

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147624
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,350,493 (GRCm39) C133Y unknown Het
Abce1 A G 8: 80,416,880 (GRCm39) M377T possibly damaging Het
Adam25 A T 8: 41,208,263 (GRCm39) R510* probably null Het
Adamts12 G T 15: 11,217,966 (GRCm39) E308* probably null Het
Adgrg3 C A 8: 95,760,070 (GRCm39) N96K possibly damaging Het
Afdn T C 17: 14,101,578 (GRCm39) V1022A probably damaging Het
Akap9 T C 5: 4,051,406 (GRCm39) V1391A probably damaging Het
Akip1 A G 7: 109,310,982 (GRCm39) Y174C probably damaging Het
Aoc1l1 A G 6: 48,952,554 (GRCm39) I160V probably benign Het
Aph1a A G 3: 95,802,876 (GRCm39) T159A probably damaging Het
Ccdc146 T C 5: 21,506,288 (GRCm39) T718A probably benign Het
Cdk5r2 T C 1: 74,894,981 (GRCm39) L242P probably damaging Het
Cep97 T A 16: 55,748,229 (GRCm39) N67I probably damaging Het
Cgas T C 9: 78,340,484 (GRCm39) D416G probably benign Het
Chic2 A T 5: 75,172,140 (GRCm39) W121R possibly damaging Het
Clock A G 5: 76,396,309 (GRCm39) S147P possibly damaging Het
Cntnap5a T G 1: 116,016,940 (GRCm39) S178A probably benign Het
Col11a2 C A 17: 34,281,529 (GRCm39) probably benign Het
Col6a3 T A 1: 90,757,936 (GRCm39) H6L probably damaging Het
Cpne5 T C 17: 29,423,667 (GRCm39) N154D probably benign Het
Ctsz T G 2: 174,269,769 (GRCm39) K273Q probably benign Het
Cybrd1 G A 2: 70,960,104 (GRCm39) V101M probably benign Het
Cyp2c23 T A 19: 43,993,990 (GRCm39) K459* probably null Het
Cyp4a31 A T 4: 115,431,933 (GRCm39) H419L probably damaging Het
D930020B18Rik G A 10: 121,477,879 (GRCm39) V35M probably damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dnah9 C T 11: 65,928,316 (GRCm39) V2118M probably benign Het
Dtna T C 18: 23,730,617 (GRCm39) probably null Het
Ednra C T 8: 78,447,025 (GRCm39) V18I possibly damaging Het
Elac1 T C 18: 73,875,717 (GRCm39) R105G probably benign Het
Exoc2 A G 13: 31,006,644 (GRCm39) S844P probably benign Het
Fam185a A T 5: 21,685,328 (GRCm39) probably null Het
Fam204a A G 19: 60,187,881 (GRCm39) M233T possibly damaging Het
Fat1 C A 8: 45,406,341 (GRCm39) H1031N probably benign Het
Fat1 T A 8: 45,491,386 (GRCm39) Y3816N probably damaging Het
Fbxo38 C T 18: 62,650,094 (GRCm39) R621Q probably benign Het
Fhod3 C A 18: 25,263,667 (GRCm39) R1524S probably damaging Het
Fnip1 A T 11: 54,378,561 (GRCm39) R192W probably damaging Het
Frem3 T A 8: 81,339,205 (GRCm39) H499Q probably damaging Het
Gab2 C T 7: 96,948,250 (GRCm39) T280I probably damaging Het
Gdpgp1 A G 7: 79,888,172 (GRCm39) R68G probably benign Het
Gm10382 C T 5: 125,466,624 (GRCm39) probably benign Het
Gmps A G 3: 63,908,938 (GRCm39) H480R probably benign Het
Hecw1 G A 13: 14,455,034 (GRCm39) R674* probably null Het
Herc2 T A 7: 55,807,257 (GRCm39) F2478L probably benign Het
Homer2 C T 7: 81,286,150 (GRCm39) V21M probably damaging Het
Ifna9 A G 4: 88,510,492 (GRCm39) M44T probably damaging Het
Igfl3 A G 7: 17,913,821 (GRCm39) D57G possibly damaging Het
Jcad T C 18: 4,673,048 (GRCm39) M270T probably benign Het
Kdm5b T C 1: 134,552,732 (GRCm39) L1236P probably damaging Het
Kif14 T A 1: 136,414,096 (GRCm39) L724Q probably damaging Het
Lhb T C 7: 45,070,757 (GRCm39) V45A probably damaging Het
Lhpp A G 7: 132,235,816 (GRCm39) N134D probably benign Het
Mas1 T C 17: 13,061,078 (GRCm39) Y115C probably damaging Het
Mgam A T 6: 40,638,234 (GRCm39) K395* probably null Het
Mms22l A G 4: 24,598,807 (GRCm39) N1134S probably damaging Het
Mrc1 A G 2: 14,330,192 (GRCm39) probably null Het
Mrgprg G A 7: 143,318,281 (GRCm39) S277L probably damaging Het
Mrpl49 G T 19: 6,107,010 (GRCm39) P60T possibly damaging Het
Mrps10 G A 17: 47,683,377 (GRCm39) G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 (GRCm39) Y120C probably damaging Het
Mtcl2 A G 2: 156,882,181 (GRCm39) C624R possibly damaging Het
N4bp2 C T 5: 65,951,861 (GRCm39) probably benign Het
Nbea A G 3: 55,550,310 (GRCm39) V2706A probably benign Het
Nfic T A 10: 81,256,518 (GRCm39) M71L possibly damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or12e1 A G 2: 87,022,222 (GRCm39) T64A possibly damaging Het
Or14j4 G T 17: 37,920,803 (GRCm39) P280T probably damaging Het
Or4a15 A G 2: 89,192,933 (GRCm39) L280P probably damaging Het
Or4c105 T A 2: 88,648,280 (GRCm39) V255E probably benign Het
Pak5 T C 2: 135,927,508 (GRCm39) I655V possibly damaging Het
Pip5k1c A G 10: 81,142,153 (GRCm39) N121S probably damaging Het
Plce1 A T 19: 38,748,521 (GRCm39) I1737F probably damaging Het
Prrt1 T C 17: 34,849,925 (GRCm39) L113P probably damaging Het
Ptprq T A 10: 107,479,860 (GRCm39) T1137S probably benign Het
Recql5 T C 11: 115,814,135 (GRCm39) I223V probably benign Het
Reg3g A T 6: 78,444,836 (GRCm39) Y47* probably null Het
Rgs12 T G 5: 35,123,165 (GRCm39) M316R probably damaging Het
Ric1 T C 19: 29,580,068 (GRCm39) S1290P probably benign Het
Rpl36al A G 12: 69,229,697 (GRCm39) C72R probably damaging Het
Rplp0 T A 5: 115,701,374 (GRCm39) F275L possibly damaging Het
Rpp30 G A 19: 36,064,793 (GRCm39) V89I probably benign Het
Ryr3 A G 2: 112,539,482 (GRCm39) F3253L possibly damaging Het
Serpina3n A T 12: 104,375,203 (GRCm39) N92Y probably benign Het
Setd7 G T 3: 51,450,252 (GRCm39) T58N probably benign Het
Sh3tc2 T A 18: 62,144,954 (GRCm39) L1136Q probably damaging Het
Slc35b4 G A 6: 34,135,440 (GRCm39) Q291* probably null Het
Sort1 A G 3: 108,248,011 (GRCm39) N452S probably benign Het
Sympk A G 7: 18,763,070 (GRCm39) I46V probably benign Het
Syngr2 T C 11: 117,703,364 (GRCm39) V60A probably damaging Het
Syt17 A T 7: 118,007,341 (GRCm39) F318I probably benign Het
Tdpoz8 T A 3: 92,981,729 (GRCm39) L249H probably damaging Het
Tgfb1 T A 7: 25,391,891 (GRCm39) L149M probably damaging Het
Ticam1 A T 17: 56,578,897 (GRCm39) M66K probably benign Het
Tmem131 G T 1: 36,847,008 (GRCm39) D1363E probably benign Het
Tns4 A C 11: 98,970,926 (GRCm39) D261E probably damaging Het
Trim30a T C 7: 104,078,417 (GRCm39) N220D probably benign Het
Trmt10a T C 3: 137,862,481 (GRCm39) L257P probably damaging Het
Troap G T 15: 98,973,233 (GRCm39) probably benign Het
Ttc6 T C 12: 57,751,338 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vav1 A C 17: 57,631,750 (GRCm39) K775T probably damaging Het
Vmn1r236 A G 17: 21,507,673 (GRCm39) K264E possibly damaging Het
Vmn1r84 A G 7: 12,096,555 (GRCm39) V46A probably benign Het
Wdr59 A T 8: 112,185,649 (GRCm39) W835R probably damaging Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Zfp7 T G 15: 76,775,977 (GRCm39) I673S probably benign Het
Zmynd11 A G 13: 9,748,737 (GRCm39) I108T possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACTCAGCAGCTAGAGAG -3'
(R):5'- TCTACCCAGATGGCTACGTG -3'

Sequencing Primer
(F):5'- AGGATAGTGAGGCCCATCC -3'
(R):5'- AGATGGCTACGTGTCTCGC -3'
Posted On 2014-06-30