Mutagenetix > Incidental Mutation

Incidental Mutation 'R1872:Ap3b2'

210846

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

039894-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R1872 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81464150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 830 (T830A)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090]

AlphaFold

Q9JME5

Predicted Effect

unknown
Transcript: ENSMUST00000082090
AA Change: T830A

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: T830A

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147624

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.4%
20x: 93.0%

Validation Efficiency

97% (113/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 108 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	C	T	3: 124,556,844	C133Y	unknown	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abce1	A	G	8: 79,690,251	M377T	possibly damaging	Het
Adam25	A	T	8: 40,755,226	R510*	probably null	Het
Adamts12	G	T	15: 11,217,880	E308*	probably null	Het
Adgrg3	C	A	8: 95,033,442	N96K	possibly damaging	Het
Afdn	T	C	17: 13,881,316	V1022A	probably damaging	Het
Akap9	T	C	5: 4,001,406	V1391A	probably damaging	Het
Akip1	A	G	7: 109,711,775	Y174C	probably damaging	Het
Aph1a	A	G	3: 95,895,564	T159A	probably damaging	Het
Ccdc146	T	C	5: 21,301,290	T718A	probably benign	Het
Cdk5r2	T	C	1: 74,855,822	L242P	probably damaging	Het
Cep97	T	A	16: 55,927,866	N67I	probably damaging	Het
Chic2	A	T	5: 75,011,479	W121R	possibly damaging	Het
Clock	A	G	5: 76,248,462	S147P	possibly damaging	Het
Cntnap5a	T	G	1: 116,089,210	S178A	probably benign	Het
Col11a2	C	A	17: 34,062,555		probably benign	Het
Col6a3	T	A	1: 90,830,214	H6L	probably damaging	Het
Cpne5	T	C	17: 29,204,693	N154D	probably benign	Het
Ctsz	T	G	2: 174,427,976	K273Q	probably benign	Het
Cybrd1	G	A	2: 71,129,760	V101M	probably benign	Het
Cyp2c23	T	A	19: 44,005,551	K459*	probably null	Het
Cyp4a31	A	T	4: 115,574,736	H419L	probably damaging	Het
D930020B18Rik	G	A	10: 121,641,974	V35M	probably damaging	Het
Dnah9	C	T	11: 66,037,490	V2118M	probably benign	Het
Doxl2	A	G	6: 48,975,620	I160V	probably benign	Het
Dtna	T	C	18: 23,597,560		probably null	Het
Ednra	C	T	8: 77,720,396	V18I	possibly damaging	Het
Elac1	T	C	18: 73,742,646	R105G	probably benign	Het
Exoc2	A	G	13: 30,822,661	S844P	probably benign	Het
Fam185a	A	T	5: 21,480,330		probably null	Het
Fam204a	A	G	19: 60,199,449	M233T	possibly damaging	Het
Fat1	C	A	8: 44,953,304	H1031N	probably benign	Het
Fat1	T	A	8: 45,038,349	Y3816N	probably damaging	Het
Fbxo38	C	T	18: 62,517,023	R621Q	probably benign	Het
Fhod3	C	A	18: 25,130,610	R1524S	probably damaging	Het
Fnip1	A	T	11: 54,487,735	R192W	probably damaging	Het
Frem3	T	A	8: 80,612,576	H499Q	probably damaging	Het
Gab2	C	T	7: 97,299,043	T280I	probably damaging	Het
Gdpgp1	A	G	7: 80,238,424	R68G	probably benign	Het
Gm10382	C	T	5: 125,389,560		probably benign	Het
Gm4858	T	A	3: 93,074,422	L249H	probably damaging	Het
Gmps	A	G	3: 64,001,517	H480R	probably benign	Het
Hecw1	G	A	13: 14,280,449	R674*	probably null	Het
Herc2	T	A	7: 56,157,509	F2478L	probably benign	Het
Homer2	C	T	7: 81,636,402	V21M	probably damaging	Het
Ifna9	A	G	4: 88,592,255	M44T	probably damaging	Het
Igfl3	A	G	7: 18,179,896	D57G	possibly damaging	Het
Jcad	T	C	18: 4,673,048	M270T	probably benign	Het
Kdm5b	T	C	1: 134,624,994	L1236P	probably damaging	Het
Kif14	T	A	1: 136,486,358	L724Q	probably damaging	Het
Lhb	T	C	7: 45,421,333	V45A	probably damaging	Het
Lhpp	A	G	7: 132,634,087	N134D	probably benign	Het
Mas1	T	C	17: 12,842,191	Y115C	probably damaging	Het
Mb21d1	T	C	9: 78,433,202	D416G	probably benign	Het
Mgam	A	T	6: 40,661,300	K395*	probably null	Het
Mms22l	A	G	4: 24,598,807	N1134S	probably damaging	Het
Mrc1	A	G	2: 14,325,381		probably null	Het
Mrgprg	G	A	7: 143,764,544	S277L	probably damaging	Het
Mrpl49	G	T	19: 6,056,980	P60T	possibly damaging	Het
Mrps10	G	A	17: 47,372,452	G104D	possibly damaging	Het
Msantd3	A	G	4: 48,552,771	Y120C	probably damaging	Het
N4bp2	C	T	5: 65,794,518		probably benign	Het
Nbea	A	G	3: 55,642,889	V2706A	probably benign	Het
Nfic	T	A	10: 81,420,684	M71L	possibly damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1112	A	G	2: 87,191,878	T64A	possibly damaging	Het
Olfr115	G	T	17: 37,609,912	P280T	probably damaging	Het
Olfr1202	T	A	2: 88,817,936	V255E	probably benign	Het
Olfr1234	A	G	2: 89,362,589	L280P	probably damaging	Het
Pak7	T	C	2: 136,085,588	I655V	possibly damaging	Het
Pip5k1c	A	G	10: 81,306,319	N121S	probably damaging	Het
Plce1	A	T	19: 38,760,077	I1737F	probably damaging	Het
Prrt1	T	C	17: 34,630,951	L113P	probably damaging	Het
Ptprq	T	A	10: 107,643,999	T1137S	probably benign	Het
Recql5	T	C	11: 115,923,309	I223V	probably benign	Het
Reg3g	A	T	6: 78,467,853	Y47*	probably null	Het
Rgs12	T	G	5: 34,965,821	M316R	probably damaging	Het
Ric1	T	C	19: 29,602,668	S1290P	probably benign	Het
Rpl36al	A	G	12: 69,182,923	C72R	probably damaging	Het
Rplp0	T	A	5: 115,563,315	F275L	possibly damaging	Het
Rpp30	G	A	19: 36,087,393	V89I	probably benign	Het
Ryr3	A	G	2: 112,709,137	F3253L	possibly damaging	Het
Serpina3n	A	T	12: 104,408,944	N92Y	probably benign	Het
Setd7	G	T	3: 51,542,831	T58N	probably benign	Het
Sh3tc2	T	A	18: 62,011,883	L1136Q	probably damaging	Het
Slc35b4	G	A	6: 34,158,505	Q291*	probably null	Het
Soga1	A	G	2: 157,040,261	C624R	possibly damaging	Het
Sort1	A	G	3: 108,340,695	N452S	probably benign	Het
Sympk	A	G	7: 19,029,145	I46V	probably benign	Het
Syngr2	T	C	11: 117,812,538	V60A	probably damaging	Het
Syt17	A	T	7: 118,408,118	F318I	probably benign	Het
Tgfb1	T	A	7: 25,692,466	L149M	probably damaging	Het
Ticam1	A	T	17: 56,271,897	M66K	probably benign	Het
Tmem131	G	T	1: 36,807,927	D1363E	probably benign	Het
Tns4	A	C	11: 99,080,100	D261E	probably damaging	Het
Trim30a	T	C	7: 104,429,210	N220D	probably benign	Het
Trmt10a	T	C	3: 138,156,720	L257P	probably damaging	Het
Troap	G	T	15: 99,075,352		probably benign	Het
Ttc6	T	C	12: 57,704,552		probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vav1	A	C	17: 57,324,750	K775T	probably damaging	Het
Vmn1r236	A	G	17: 21,287,411	K264E	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,628	V46A	probably benign	Het
Wdr59	A	T	8: 111,459,017	W835R	probably damaging	Het
Zfp513	T	G	5: 31,200,423	K202T	probably damaging	Het
Zfp7	T	G	15: 76,891,777	I673S	probably benign	Het
Zmynd11	A	G	13: 9,698,701	I108T	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGACTCAGCAGCTAGAGAG -3'
(R):5'- TCTACCCAGATGGCTACGTG -3'

Sequencing Primer
(F):5'- AGGATAGTGAGGCCCATCC -3'
(R):5'- AGATGGCTACGTGTCTCGC -3'

Posted On

2014-06-30