Incidental Mutation 'R1872:Lhpp'
ID 210852
Institutional Source Beutler Lab
Gene Symbol Lhpp
Ensembl Gene ENSMUSG00000030946
Gene Name phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Synonyms 2310007H09Rik
MMRRC Submission 039894-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R1872 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 132212367-132308149 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132235816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 134 (N134D)
Ref Sequence ENSEMBL: ENSMUSP00000147970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033241] [ENSMUST00000106170] [ENSMUST00000124096] [ENSMUST00000148669]
AlphaFold Q9D7I5
Predicted Effect probably benign
Transcript: ENSMUST00000033241
AA Change: N134D

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033241
Gene: ENSMUSG00000030946
AA Change: N134D

DomainStartEndE-ValueType
Pfam:Hydrolase 11 227 1.1e-8 PFAM
Pfam:Hydrolase_6 14 116 4.4e-17 PFAM
Pfam:HAD_2 159 233 3.4e-9 PFAM
Pfam:Hydrolase_like 186 260 9.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106170
AA Change: N134D

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130672
Predicted Effect probably benign
Transcript: ENSMUST00000133969
Predicted Effect probably benign
Transcript: ENSMUST00000148669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210168
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency 97% (113/117)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,350,493 (GRCm39) C133Y unknown Het
Abce1 A G 8: 80,416,880 (GRCm39) M377T possibly damaging Het
Adam25 A T 8: 41,208,263 (GRCm39) R510* probably null Het
Adamts12 G T 15: 11,217,966 (GRCm39) E308* probably null Het
Adgrg3 C A 8: 95,760,070 (GRCm39) N96K possibly damaging Het
Afdn T C 17: 14,101,578 (GRCm39) V1022A probably damaging Het
Akap9 T C 5: 4,051,406 (GRCm39) V1391A probably damaging Het
Akip1 A G 7: 109,310,982 (GRCm39) Y174C probably damaging Het
Aoc1l1 A G 6: 48,952,554 (GRCm39) I160V probably benign Het
Ap3b2 T C 7: 81,113,898 (GRCm39) T830A unknown Het
Aph1a A G 3: 95,802,876 (GRCm39) T159A probably damaging Het
Ccdc146 T C 5: 21,506,288 (GRCm39) T718A probably benign Het
Cdk5r2 T C 1: 74,894,981 (GRCm39) L242P probably damaging Het
Cep97 T A 16: 55,748,229 (GRCm39) N67I probably damaging Het
Cgas T C 9: 78,340,484 (GRCm39) D416G probably benign Het
Chic2 A T 5: 75,172,140 (GRCm39) W121R possibly damaging Het
Clock A G 5: 76,396,309 (GRCm39) S147P possibly damaging Het
Cntnap5a T G 1: 116,016,940 (GRCm39) S178A probably benign Het
Col11a2 C A 17: 34,281,529 (GRCm39) probably benign Het
Col6a3 T A 1: 90,757,936 (GRCm39) H6L probably damaging Het
Cpne5 T C 17: 29,423,667 (GRCm39) N154D probably benign Het
Ctsz T G 2: 174,269,769 (GRCm39) K273Q probably benign Het
Cybrd1 G A 2: 70,960,104 (GRCm39) V101M probably benign Het
Cyp2c23 T A 19: 43,993,990 (GRCm39) K459* probably null Het
Cyp4a31 A T 4: 115,431,933 (GRCm39) H419L probably damaging Het
D930020B18Rik G A 10: 121,477,879 (GRCm39) V35M probably damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dnah9 C T 11: 65,928,316 (GRCm39) V2118M probably benign Het
Dtna T C 18: 23,730,617 (GRCm39) probably null Het
Ednra C T 8: 78,447,025 (GRCm39) V18I possibly damaging Het
Elac1 T C 18: 73,875,717 (GRCm39) R105G probably benign Het
Exoc2 A G 13: 31,006,644 (GRCm39) S844P probably benign Het
Fam185a A T 5: 21,685,328 (GRCm39) probably null Het
Fam204a A G 19: 60,187,881 (GRCm39) M233T possibly damaging Het
Fat1 C A 8: 45,406,341 (GRCm39) H1031N probably benign Het
Fat1 T A 8: 45,491,386 (GRCm39) Y3816N probably damaging Het
Fbxo38 C T 18: 62,650,094 (GRCm39) R621Q probably benign Het
Fhod3 C A 18: 25,263,667 (GRCm39) R1524S probably damaging Het
Fnip1 A T 11: 54,378,561 (GRCm39) R192W probably damaging Het
Frem3 T A 8: 81,339,205 (GRCm39) H499Q probably damaging Het
Gab2 C T 7: 96,948,250 (GRCm39) T280I probably damaging Het
Gdpgp1 A G 7: 79,888,172 (GRCm39) R68G probably benign Het
Gm10382 C T 5: 125,466,624 (GRCm39) probably benign Het
Gmps A G 3: 63,908,938 (GRCm39) H480R probably benign Het
Hecw1 G A 13: 14,455,034 (GRCm39) R674* probably null Het
Herc2 T A 7: 55,807,257 (GRCm39) F2478L probably benign Het
Homer2 C T 7: 81,286,150 (GRCm39) V21M probably damaging Het
Ifna9 A G 4: 88,510,492 (GRCm39) M44T probably damaging Het
Igfl3 A G 7: 17,913,821 (GRCm39) D57G possibly damaging Het
Jcad T C 18: 4,673,048 (GRCm39) M270T probably benign Het
Kdm5b T C 1: 134,552,732 (GRCm39) L1236P probably damaging Het
Kif14 T A 1: 136,414,096 (GRCm39) L724Q probably damaging Het
Lhb T C 7: 45,070,757 (GRCm39) V45A probably damaging Het
Mas1 T C 17: 13,061,078 (GRCm39) Y115C probably damaging Het
Mgam A T 6: 40,638,234 (GRCm39) K395* probably null Het
Mms22l A G 4: 24,598,807 (GRCm39) N1134S probably damaging Het
Mrc1 A G 2: 14,330,192 (GRCm39) probably null Het
Mrgprg G A 7: 143,318,281 (GRCm39) S277L probably damaging Het
Mrpl49 G T 19: 6,107,010 (GRCm39) P60T possibly damaging Het
Mrps10 G A 17: 47,683,377 (GRCm39) G104D possibly damaging Het
Msantd3 A G 4: 48,552,771 (GRCm39) Y120C probably damaging Het
Mtcl2 A G 2: 156,882,181 (GRCm39) C624R possibly damaging Het
N4bp2 C T 5: 65,951,861 (GRCm39) probably benign Het
Nbea A G 3: 55,550,310 (GRCm39) V2706A probably benign Het
Nfic T A 10: 81,256,518 (GRCm39) M71L possibly damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or12e1 A G 2: 87,022,222 (GRCm39) T64A possibly damaging Het
Or14j4 G T 17: 37,920,803 (GRCm39) P280T probably damaging Het
Or4a15 A G 2: 89,192,933 (GRCm39) L280P probably damaging Het
Or4c105 T A 2: 88,648,280 (GRCm39) V255E probably benign Het
Pak5 T C 2: 135,927,508 (GRCm39) I655V possibly damaging Het
Pip5k1c A G 10: 81,142,153 (GRCm39) N121S probably damaging Het
Plce1 A T 19: 38,748,521 (GRCm39) I1737F probably damaging Het
Prrt1 T C 17: 34,849,925 (GRCm39) L113P probably damaging Het
Ptprq T A 10: 107,479,860 (GRCm39) T1137S probably benign Het
Recql5 T C 11: 115,814,135 (GRCm39) I223V probably benign Het
Reg3g A T 6: 78,444,836 (GRCm39) Y47* probably null Het
Rgs12 T G 5: 35,123,165 (GRCm39) M316R probably damaging Het
Ric1 T C 19: 29,580,068 (GRCm39) S1290P probably benign Het
Rpl36al A G 12: 69,229,697 (GRCm39) C72R probably damaging Het
Rplp0 T A 5: 115,701,374 (GRCm39) F275L possibly damaging Het
Rpp30 G A 19: 36,064,793 (GRCm39) V89I probably benign Het
Ryr3 A G 2: 112,539,482 (GRCm39) F3253L possibly damaging Het
Serpina3n A T 12: 104,375,203 (GRCm39) N92Y probably benign Het
Setd7 G T 3: 51,450,252 (GRCm39) T58N probably benign Het
Sh3tc2 T A 18: 62,144,954 (GRCm39) L1136Q probably damaging Het
Slc35b4 G A 6: 34,135,440 (GRCm39) Q291* probably null Het
Sort1 A G 3: 108,248,011 (GRCm39) N452S probably benign Het
Sympk A G 7: 18,763,070 (GRCm39) I46V probably benign Het
Syngr2 T C 11: 117,703,364 (GRCm39) V60A probably damaging Het
Syt17 A T 7: 118,007,341 (GRCm39) F318I probably benign Het
Tdpoz8 T A 3: 92,981,729 (GRCm39) L249H probably damaging Het
Tgfb1 T A 7: 25,391,891 (GRCm39) L149M probably damaging Het
Ticam1 A T 17: 56,578,897 (GRCm39) M66K probably benign Het
Tmem131 G T 1: 36,847,008 (GRCm39) D1363E probably benign Het
Tns4 A C 11: 98,970,926 (GRCm39) D261E probably damaging Het
Trim30a T C 7: 104,078,417 (GRCm39) N220D probably benign Het
Trmt10a T C 3: 137,862,481 (GRCm39) L257P probably damaging Het
Troap G T 15: 98,973,233 (GRCm39) probably benign Het
Ttc6 T C 12: 57,751,338 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vav1 A C 17: 57,631,750 (GRCm39) K775T probably damaging Het
Vmn1r236 A G 17: 21,507,673 (GRCm39) K264E possibly damaging Het
Vmn1r84 A G 7: 12,096,555 (GRCm39) V46A probably benign Het
Wdr59 A T 8: 112,185,649 (GRCm39) W835R probably damaging Het
Zfp513 T G 5: 31,357,767 (GRCm39) K202T probably damaging Het
Zfp7 T G 15: 76,775,977 (GRCm39) I673S probably benign Het
Zmynd11 A G 13: 9,748,737 (GRCm39) I108T possibly damaging Het
Other mutations in Lhpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Lhpp APN 7 132,244,249 (GRCm39) missense probably damaging 1.00
IGL02695:Lhpp APN 7 132,252,063 (GRCm39) missense probably damaging 1.00
IGL03220:Lhpp APN 7 132,252,020 (GRCm39) missense probably benign 0.02
R0105:Lhpp UTSW 7 132,232,254 (GRCm39) missense probably damaging 0.99
R0200:Lhpp UTSW 7 132,212,406 (GRCm39) start gained probably benign
R0463:Lhpp UTSW 7 132,212,406 (GRCm39) start gained probably benign
R1103:Lhpp UTSW 7 132,212,484 (GRCm39) missense probably damaging 1.00
R4816:Lhpp UTSW 7 132,272,104 (GRCm39) nonsense probably null
R5140:Lhpp UTSW 7 132,307,361 (GRCm39) missense probably damaging 0.99
R5799:Lhpp UTSW 7 132,307,364 (GRCm39) missense probably damaging 1.00
R6816:Lhpp UTSW 7 132,235,762 (GRCm39) missense probably benign 0.01
R8503:Lhpp UTSW 7 132,307,406 (GRCm39) missense probably benign
R8738:Lhpp UTSW 7 132,243,261 (GRCm39) missense probably damaging 1.00
R8996:Lhpp UTSW 7 132,212,484 (GRCm39) missense probably damaging 1.00
R9108:Lhpp UTSW 7 132,252,018 (GRCm39) missense probably damaging 1.00
R9474:Lhpp UTSW 7 132,243,312 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAAATACATTTTCTGCCAGGC -3'
(R):5'- TTGGTCAGACAGCTCTGGAAAG -3'

Sequencing Primer
(F):5'- GCAGACCTGGCAGAGGAAG -3'
(R):5'- AGAGCCCCTGTGCTCACTC -3'
Posted On 2014-06-30