Incidental Mutation 'R0122:Zfp110'
ID21091
Institutional Source Beutler Lab
Gene Symbol Zfp110
Ensembl Gene ENSMUSG00000058638
Gene Namezinc finger protein 110
SynonymsNrif1, NRIF, 2900024E01Rik
MMRRC Submission 038407-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R0122 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location12834761-12850577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12848597 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 391 (H391N)
Ref Sequence ENSEMBL: ENSMUSP00000132060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004614] [ENSMUST00000168247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004614
AA Change: H391N

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000004614
Gene: ENSMUSG00000058638
AA Change: H391N

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137718
Predicted Effect possibly damaging
Transcript: ENSMUST00000168247
AA Change: H391N

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132060
Gene: ENSMUSG00000058638
AA Change: H391N

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Homozygous mutants on a C57BL/6 background die at embryonic day 12. On a strain 129 background, mutants are viable and fertile, but males are more docile and testis weight is greatly reduced. On an F2 background, 20% of homozygous pups die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Adam12 T A 7: 134,012,348 I60F probably benign Het
Adamts10 A G 17: 33,528,480 probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Adamts7 A G 9: 90,179,421 E360G probably damaging Het
Atn1 A T 6: 124,743,234 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Baz2b G T 2: 59,913,619 probably null Het
Bloc1s6 G C 2: 122,746,043 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qa T A 4: 136,897,831 T3S probably benign Het
Cacna1e A T 1: 154,443,901 F1351Y probably damaging Het
Car9 C T 4: 43,512,206 A356V probably benign Het
Ccdc116 T A 16: 17,142,734 D73V probably damaging Het
Ces2g T C 8: 104,968,300 Y518H probably damaging Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cmc1 A T 9: 118,065,320 C29S probably damaging Het
Coil T A 11: 88,985,007 probably benign Het
Col3a1 C T 1: 45,340,897 probably benign Het
Cox15 A G 19: 43,748,790 I135T possibly damaging Het
Cyld T C 8: 88,742,292 S564P probably damaging Het
Dnah5 T A 15: 28,378,363 N2948K probably damaging Het
Dnah7a G A 1: 53,397,142 R4014W probably damaging Het
Dnmt3b T C 2: 153,676,698 Y594H probably damaging Het
Dntt A G 19: 41,053,038 K387R possibly damaging Het
Efcab7 G A 4: 99,892,363 probably benign Het
Flvcr1 G T 1: 191,021,226 P250T possibly damaging Het
Gga2 C A 7: 121,991,574 V504L probably damaging Het
Gm12239 T A 11: 56,015,912 noncoding transcript Het
Gm13089 A T 4: 143,698,404 D156E probably benign Het
Gm6327 T C 16: 12,761,026 noncoding transcript Het
Krt26 G T 11: 99,333,719 Y324* probably null Het
Lamb2 A T 9: 108,486,514 H939L probably benign Het
Lipo3 C T 19: 33,622,686 probably benign Het
Mmp1b G A 9: 7,386,689 T145M probably damaging Het
Mrps27 G T 13: 99,365,228 V76L probably benign Het
Mup6 T A 4: 60,003,995 Y29* probably null Het
Nlrc3 T C 16: 3,958,958 K756E probably damaging Het
Nnt T C 13: 119,368,597 H527R probably damaging Het
Nudt8 T C 19: 4,001,306 V59A probably benign Het
Ofcc1 A T 13: 40,280,556 probably null Het
Olfr447 T C 6: 42,911,955 V144A probably benign Het
Olfr638 T C 7: 104,003,358 W28R probably damaging Het
Olfr959 A T 9: 39,572,724 D178E probably damaging Het
Pdgfd T C 9: 6,293,851 S142P probably damaging Het
Pias4 G T 10: 81,157,087 Q22K probably damaging Het
Pin1 T C 9: 20,662,304 I95T probably benign Het
Prickle2 G A 6: 92,411,345 Q359* probably null Het
Qrich2 G T 11: 116,446,813 Q1950K possibly damaging Het
Rab10 C A 12: 3,309,357 G21V probably damaging Het
Rbm27 T A 18: 42,313,968 probably benign Het
Samd4 C A 14: 47,016,560 S160R probably benign Het
Scube3 A C 17: 28,166,528 probably benign Het
Serpinf2 A G 11: 75,436,546 L185P probably damaging Het
Slc16a12 A G 19: 34,674,864 I294T probably benign Het
Slc45a3 T A 1: 131,977,740 M167K probably damaging Het
Sspo T A 6: 48,473,976 L2673Q possibly damaging Het
Supt3 A G 17: 45,003,141 D139G probably damaging Het
Tas1r3 T C 4: 155,860,833 M644V probably benign Het
Tgfbi A G 13: 56,627,968 T276A probably damaging Het
Tmem177 T C 1: 119,910,578 I124V probably benign Het
Tmprss11f G T 5: 86,533,625 probably benign Het
Tmprss3 G A 17: 31,193,902 probably benign Het
Twf1 A G 15: 94,586,549 probably benign Het
Uba52 T A 8: 70,509,301 Q166L probably damaging Het
Ubr3 G T 2: 69,979,412 G1242V probably damaging Het
Unc13d C T 11: 116,065,482 S835N probably benign Het
Ush2a A G 1: 188,948,455 K4877E possibly damaging Het
Vmn2r98 A G 17: 19,066,400 I387V probably benign Het
Vps11 A T 9: 44,354,512 I490N probably damaging Het
Vstm4 T A 14: 32,863,811 probably null Het
Zfp212 C T 6: 47,931,023 P312L possibly damaging Het
Zfp329 A T 7: 12,810,987 H203Q probably damaging Het
Zscan12 G A 13: 21,368,969 G321E probably damaging Het
Other mutations in Zfp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp110 APN 7 12849159 missense probably benign 0.38
IGL01094:Zfp110 APN 7 12849796 missense probably damaging 1.00
IGL01576:Zfp110 APN 7 12849671 missense probably damaging 1.00
IGL01859:Zfp110 APN 7 12849540 missense possibly damaging 0.86
IGL02003:Zfp110 APN 7 12849905 nonsense probably null
R0357:Zfp110 UTSW 7 12836375 missense probably damaging 0.98
R0383:Zfp110 UTSW 7 12849260 missense probably benign 0.00
R0725:Zfp110 UTSW 7 12836363 missense possibly damaging 0.52
R0926:Zfp110 UTSW 7 12849881 nonsense probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1472:Zfp110 UTSW 7 12848541 missense possibly damaging 0.85
R1663:Zfp110 UTSW 7 12848642 missense probably benign 0.08
R1975:Zfp110 UTSW 7 12848502 missense probably benign 0.00
R2046:Zfp110 UTSW 7 12849422 missense probably benign 0.00
R2296:Zfp110 UTSW 7 12849540 missense probably damaging 0.97
R2341:Zfp110 UTSW 7 12849186 missense probably benign 0.04
R4332:Zfp110 UTSW 7 12844571 nonsense probably null
R5892:Zfp110 UTSW 7 12848478 missense probably benign 0.00
R5955:Zfp110 UTSW 7 12848745 missense possibly damaging 0.85
R6083:Zfp110 UTSW 7 12844675 missense possibly damaging 0.95
R6115:Zfp110 UTSW 7 12849774 missense probably damaging 0.98
R7187:Zfp110 UTSW 7 12849826 nonsense probably null
R7455:Zfp110 UTSW 7 12848057 missense probably benign
R7570:Zfp110 UTSW 7 12849340 missense possibly damaging 0.94
R7727:Zfp110 UTSW 7 12848995 missense possibly damaging 0.91
R7895:Zfp110 UTSW 7 12837093 missense possibly damaging 0.86
R8179:Zfp110 UTSW 7 12844571 nonsense probably null
R8703:Zfp110 UTSW 7 12848961 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAAGCTCCTGGTTTTGCTGCTTC -3'
(R):5'- GAAATGGTGTTTGTCCTGCCTTTCC -3'

Sequencing Primer
(F):5'- TTGTCACTCCCTAGACGGAAG -3'
(R):5'- TGCCTTTCCTCTTTCCAGTG -3'
Posted On2013-04-11