Incidental Mutation 'R1873:Dnah7a'
ID210910
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 53456532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably benign
Transcript: ENSMUST00000094964
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Cluh C T 11: 74,662,076 A649V possibly damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gnrhr A G 5: 86,182,201 L320P probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Mark2 A G 19: 7,284,515 Y351H probably damaging Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tarbp1 A G 8: 126,447,047 I976T probably damaging Het
Tex14 T A 11: 87,499,605 V376D probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zc3hav1 C T 6: 38,332,757 V377I possibly damaging Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 intron probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACAGCTCTGTAAACCATTATTT -3'
(R):5'- AGAAGTTCTCTCATTATCAGAAGGC -3'

Sequencing Primer
(F):5'- AGCTCTGTAAACCATTATTTCCCAAC -3'
(R):5'- AGATTGACATTACCCGCATGG -3'
Posted On2014-06-30