Incidental Mutation 'R1873:Zc3hav1'
ID210931
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38332757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 377 (V377I)
Ref Sequence ENSEMBL: ENSMUSP00000110548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031850] [ENSMUST00000114898] [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably benign
Transcript: ENSMUST00000031850
AA Change: V377I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031850
Gene: ENSMUSG00000029826
AA Change: V377I

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 9.6e-6 PROSPERO
internal_repeat_1 166 208 9.6e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114898
AA Change: V377I

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110548
Gene: ENSMUSG00000029826
AA Change: V377I

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 8.18e-6 PROSPERO
internal_repeat_1 166 208 8.18e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114900
AA Change: V377I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: V377I

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143702
AA Change: V377I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826
AA Change: V377I

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Cluh C T 11: 74,662,076 A649V possibly damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gnrhr A G 5: 86,182,201 L320P probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Mark2 A G 19: 7,284,515 Y351H probably damaging Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tarbp1 A G 8: 126,447,047 I976T probably damaging Het
Tex14 T A 11: 87,499,605 V376D probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38307237 missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38332393 nonsense probably null
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7506:Zc3hav1 UTSW 6 38332940 nonsense probably null
R7593:Zc3hav1 UTSW 6 38329186 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTATGCAGGAATGCCGTGTC -3'
(R):5'- CAGTCAAATGAGAGCAAGCC -3'

Sequencing Primer
(F):5'- TCAGTGATTCTGCCAGCG -3'
(R):5'- AGCAAGCCAGGAGTTTTTGG -3'
Posted On2014-06-30