Incidental Mutation 'R0122:Adam12'
ID 21094
Institutional Source Beutler Lab
Gene Symbol Adam12
Ensembl Gene ENSMUSG00000054555
Gene Name ADAM metallopeptidase domain 12
Synonyms Mltna, ADAM12
MMRRC Submission 038407-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.386) question?
Stock # R0122 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 133484928-133826826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133614077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 60 (I60F)
Ref Sequence ENSEMBL: ENSMUSP00000120094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000127524] [ENSMUST00000134504]
AlphaFold Q61824
Predicted Effect probably benign
Transcript: ENSMUST00000067680
AA Change: I91F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: I91F

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127524
AA Change: I60F

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120094
Gene: ENSMUSG00000054555
AA Change: I60F

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 4.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134504
AA Change: I60F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123161
Gene: ENSMUSG00000054555
AA Change: I60F

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 6.1e-36 PFAM
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
Adamts10 A G 17: 33,747,454 (GRCm39) probably benign Het
Adamts12 C T 15: 11,215,710 (GRCm39) R244C probably damaging Het
Adamts7 A G 9: 90,061,474 (GRCm39) E360G probably damaging Het
Atn1 A T 6: 124,720,197 (GRCm39) probably benign Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
Baz2b G T 2: 59,743,963 (GRCm39) probably null Het
Bloc1s6 G C 2: 122,587,963 (GRCm39) probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
C1qa T A 4: 136,625,142 (GRCm39) T3S probably benign Het
Cacna1e A T 1: 154,319,647 (GRCm39) F1351Y probably damaging Het
Car9 C T 4: 43,512,206 (GRCm39) A356V probably benign Het
Ccdc116 T A 16: 16,960,598 (GRCm39) D73V probably damaging Het
Ces2g T C 8: 105,694,932 (GRCm39) Y518H probably damaging Het
Ciz1 A G 2: 32,261,431 (GRCm39) probably benign Het
Cmc1 A T 9: 117,894,388 (GRCm39) C29S probably damaging Het
Coil T A 11: 88,875,833 (GRCm39) probably benign Het
Col3a1 C T 1: 45,380,057 (GRCm39) probably benign Het
Cox15 A G 19: 43,737,229 (GRCm39) I135T possibly damaging Het
Cyld T C 8: 89,468,920 (GRCm39) S564P probably damaging Het
Dnah5 T A 15: 28,378,509 (GRCm39) N2948K probably damaging Het
Dnah7a G A 1: 53,436,301 (GRCm39) R4014W probably damaging Het
Dnmt3b T C 2: 153,518,618 (GRCm39) Y594H probably damaging Het
Dntt A G 19: 41,041,477 (GRCm39) K387R possibly damaging Het
Efcab7 G A 4: 99,749,560 (GRCm39) probably benign Het
Flvcr1 G T 1: 190,753,423 (GRCm39) P250T possibly damaging Het
Gga2 C A 7: 121,590,797 (GRCm39) V504L probably damaging Het
Gm12239 T A 11: 55,906,738 (GRCm39) noncoding transcript Het
Gm6327 T C 16: 12,578,890 (GRCm39) noncoding transcript Het
Krt26 G T 11: 99,224,545 (GRCm39) Y324* probably null Het
Lamb2 A T 9: 108,363,713 (GRCm39) H939L probably benign Het
Lipo3 C T 19: 33,600,086 (GRCm39) probably benign Het
Mmp1b G A 9: 7,386,689 (GRCm39) T145M probably damaging Het
Mrps27 G T 13: 99,501,736 (GRCm39) V76L probably benign Het
Mup6 T A 4: 60,003,995 (GRCm39) Y29* probably null Het
Nlrc3 T C 16: 3,776,822 (GRCm39) K756E probably damaging Het
Nnt T C 13: 119,505,133 (GRCm39) H527R probably damaging Het
Nudt8 T C 19: 4,051,306 (GRCm39) V59A probably benign Het
Ofcc1 A T 13: 40,434,032 (GRCm39) probably null Het
Or10d1 A T 9: 39,484,020 (GRCm39) D178E probably damaging Het
Or2a25 T C 6: 42,888,889 (GRCm39) V144A probably benign Het
Or51q1c T C 7: 103,652,565 (GRCm39) W28R probably damaging Het
Pdgfd T C 9: 6,293,851 (GRCm39) S142P probably damaging Het
Pias4 G T 10: 80,992,921 (GRCm39) Q22K probably damaging Het
Pin1 T C 9: 20,573,600 (GRCm39) I95T probably benign Het
Pramel23 A T 4: 143,424,974 (GRCm39) D156E probably benign Het
Prickle2 G A 6: 92,388,326 (GRCm39) Q359* probably null Het
Qrich2 G T 11: 116,337,639 (GRCm39) Q1950K possibly damaging Het
Rab10 C A 12: 3,359,357 (GRCm39) G21V probably damaging Het
Rbm27 T A 18: 42,447,033 (GRCm39) probably benign Het
Samd4 C A 14: 47,254,017 (GRCm39) S160R probably benign Het
Scube3 A C 17: 28,385,502 (GRCm39) probably benign Het
Serpinf2 A G 11: 75,327,372 (GRCm39) L185P probably damaging Het
Slc16a12 A G 19: 34,652,264 (GRCm39) I294T probably benign Het
Slc45a3 T A 1: 131,905,478 (GRCm39) M167K probably damaging Het
Sspo T A 6: 48,450,910 (GRCm39) L2673Q possibly damaging Het
Supt3 A G 17: 45,314,028 (GRCm39) D139G probably damaging Het
Tas1r3 T C 4: 155,945,290 (GRCm39) M644V probably benign Het
Tgfbi A G 13: 56,775,781 (GRCm39) T276A probably damaging Het
Tmem177 T C 1: 119,838,308 (GRCm39) I124V probably benign Het
Tmprss11f G T 5: 86,681,484 (GRCm39) probably benign Het
Tmprss3 G A 17: 31,412,876 (GRCm39) probably benign Het
Twf1 A G 15: 94,484,430 (GRCm39) probably benign Het
Uba52 T A 8: 70,961,951 (GRCm39) Q166L probably damaging Het
Ubr3 G T 2: 69,809,756 (GRCm39) G1242V probably damaging Het
Unc13d C T 11: 115,956,308 (GRCm39) S835N probably benign Het
Ush2a A G 1: 188,680,652 (GRCm39) K4877E possibly damaging Het
Vmn2r98 A G 17: 19,286,662 (GRCm39) I387V probably benign Het
Vps11 A T 9: 44,265,809 (GRCm39) I490N probably damaging Het
Vstm4 T A 14: 32,585,768 (GRCm39) probably null Het
Zfp110 C A 7: 12,582,524 (GRCm39) H391N possibly damaging Het
Zfp212 C T 6: 47,907,957 (GRCm39) P312L possibly damaging Het
Zfp329 A T 7: 12,544,914 (GRCm39) H203Q probably damaging Het
Zscan12 G A 13: 21,553,139 (GRCm39) G321E probably damaging Het
Other mutations in Adam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Adam12 APN 7 133,511,610 (GRCm39) missense possibly damaging 0.51
IGL01403:Adam12 APN 7 133,521,339 (GRCm39) missense probably benign 0.00
IGL01482:Adam12 APN 7 133,569,577 (GRCm39) missense probably damaging 1.00
IGL01922:Adam12 APN 7 133,539,201 (GRCm39) nonsense probably null
IGL02397:Adam12 APN 7 133,511,548 (GRCm39) splice site probably benign
IGL03401:Adam12 APN 7 133,518,192 (GRCm39) missense probably damaging 1.00
R0200:Adam12 UTSW 7 133,576,145 (GRCm39) splice site probably null
R0463:Adam12 UTSW 7 133,576,145 (GRCm39) splice site probably null
R0927:Adam12 UTSW 7 133,599,959 (GRCm39) missense probably damaging 1.00
R1258:Adam12 UTSW 7 133,539,176 (GRCm39) missense probably damaging 1.00
R1440:Adam12 UTSW 7 133,533,543 (GRCm39) missense probably benign 0.03
R1483:Adam12 UTSW 7 133,531,754 (GRCm39) missense probably benign 0.41
R1692:Adam12 UTSW 7 133,489,673 (GRCm39) makesense probably null
R1797:Adam12 UTSW 7 133,569,590 (GRCm39) missense probably benign 0.03
R2134:Adam12 UTSW 7 133,614,017 (GRCm39) nonsense probably null
R2230:Adam12 UTSW 7 133,521,347 (GRCm39) missense probably damaging 1.00
R2350:Adam12 UTSW 7 133,521,253 (GRCm39) missense probably damaging 1.00
R2944:Adam12 UTSW 7 133,577,236 (GRCm39) missense probably null 0.02
R3688:Adam12 UTSW 7 133,566,525 (GRCm39) nonsense probably null
R3747:Adam12 UTSW 7 133,774,594 (GRCm39) missense probably damaging 0.96
R3749:Adam12 UTSW 7 133,774,594 (GRCm39) missense probably damaging 0.96
R3750:Adam12 UTSW 7 133,774,594 (GRCm39) missense probably damaging 0.96
R4028:Adam12 UTSW 7 133,531,725 (GRCm39) missense probably damaging 1.00
R4130:Adam12 UTSW 7 133,514,653 (GRCm39) missense probably damaging 1.00
R4131:Adam12 UTSW 7 133,514,653 (GRCm39) missense probably damaging 1.00
R4346:Adam12 UTSW 7 133,583,264 (GRCm39) missense possibly damaging 0.82
R4701:Adam12 UTSW 7 133,518,191 (GRCm39) missense possibly damaging 0.64
R4887:Adam12 UTSW 7 133,774,550 (GRCm39) missense possibly damaging 0.74
R5355:Adam12 UTSW 7 133,489,671 (GRCm39) makesense probably null
R5468:Adam12 UTSW 7 133,577,202 (GRCm39) missense probably damaging 1.00
R5486:Adam12 UTSW 7 133,509,401 (GRCm39) missense possibly damaging 0.75
R5990:Adam12 UTSW 7 133,533,465 (GRCm39) missense probably damaging 1.00
R6504:Adam12 UTSW 7 133,531,713 (GRCm39) missense probably damaging 1.00
R6783:Adam12 UTSW 7 133,576,126 (GRCm39) missense probably damaging 1.00
R7117:Adam12 UTSW 7 133,518,191 (GRCm39) missense probably benign 0.00
R7263:Adam12 UTSW 7 133,521,240 (GRCm39) missense possibly damaging 0.68
R7749:Adam12 UTSW 7 133,826,542 (GRCm39) missense unknown
R7820:Adam12 UTSW 7 133,599,917 (GRCm39) missense probably benign 0.00
R7880:Adam12 UTSW 7 133,511,691 (GRCm39) missense possibly damaging 0.94
R7891:Adam12 UTSW 7 133,599,961 (GRCm39) missense probably benign 0.00
R8114:Adam12 UTSW 7 133,569,617 (GRCm39) missense probably damaging 1.00
R8160:Adam12 UTSW 7 133,569,770 (GRCm39) splice site probably null
R8683:Adam12 UTSW 7 133,491,929 (GRCm39) missense possibly damaging 0.49
R9236:Adam12 UTSW 7 133,614,022 (GRCm39) missense probably benign 0.03
R9277:Adam12 UTSW 7 133,521,561 (GRCm39) missense probably benign 0.00
R9480:Adam12 UTSW 7 133,736,470 (GRCm39) missense probably damaging 0.98
R9515:Adam12 UTSW 7 133,509,373 (GRCm39) missense probably benign 0.03
R9599:Adam12 UTSW 7 133,566,454 (GRCm39) missense probably damaging 0.99
X0057:Adam12 UTSW 7 133,614,044 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTAGCTCAGAACAAAACGGCTAC -3'
(R):5'- CATGGTGAATGCTAAACTTTGCACCTG -3'

Sequencing Primer
(F):5'- CGGCTACAAAAGTGTCAGC -3'
(R):5'- CTCAAAACATCTGTTGGAGGCTG -3'
Posted On 2013-04-11