Mutagenetix > Incidental Mutations

Incidental Mutation 'R1873:Csgalnact1'

210943

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

039895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R1873 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68401384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 255 (N255S)

Ref Sequence

ENSEMBL: ENSMUSP00000116134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]

AlphaFold

Q8BJQ9

Predicted Effect

probably benign
Transcript: ENSMUST00000078350
AA Change: N255S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: N255S

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130214
AA Change: N255S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: N255S

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136060
AA Change: N255S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: N255S

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	66	300	1.6e-11	PFAM

Meta Mutation Damage Score

0.0837

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.4%
20x: 92.9%

Validation Efficiency

98% (82/84)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,979,955	I124L	probably benign	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Adam34	A	C	8: 43,651,806	N267K	probably benign	Het
Anxa5	T	C	3: 36,449,402	D301G	probably damaging	Het
Atf7ip	G	T	6: 136,559,888	D40Y	probably damaging	Het
Cacna2d2	T	G	9: 107,513,872	M400R	probably damaging	Het
Cd96	C	A	16: 46,117,972	L43F	probably damaging	Het
Cep120	T	C	18: 53,738,488	E104G	probably damaging	Het
Cfap221	T	C	1: 119,953,659	I358V	probably benign	Het
Chil4	C	T	3: 106,206,098	E168K	probably benign	Het
Clca3a1	A	G	3: 144,746,829	V631A	probably damaging	Het
Cluh	C	T	11: 74,662,076	A649V	possibly damaging	Het
Commd9	A	G	2: 101,897,157	T99A	probably benign	Het
Cyth3	T	A	5: 143,697,761	H138Q	possibly damaging	Het
Dnah7a	A	T	1: 53,456,532		probably benign	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fyco1	A	G	9: 123,823,238	V1135A	probably benign	Het
Glcci1	C	A	6: 8,537,837	H152N	probably benign	Het
Gm10477	T	A	X: 56,524,767	F9Y	probably damaging	Het
Gm4788	C	T	1: 139,774,660	E29K	probably damaging	Het
Gnrhr	A	G	5: 86,182,201	L320P	probably damaging	Het
Gorasp1	A	T	9: 119,930,240	S138T	probably benign	Het
Hars	C	A	18: 36,767,241	Q469H	probably damaging	Het
Homer2	T	C	7: 81,636,363	K34E	probably damaging	Het
Hscb	T	C	5: 110,830,957	I198V	probably benign	Het
Kat6b	T	C	14: 21,516,989	S39P	probably damaging	Het
Kcnk12	G	T	17: 87,746,071	Q388K	probably damaging	Het
Kcnq3	A	G	15: 66,002,255	I548T	probably benign	Het
Mark2	A	G	19: 7,284,515	Y351H	probably damaging	Het
Masp2	A	T	4: 148,614,495	I678F	probably damaging	Het
Mc4r	A	T	18: 66,859,460	I194N	probably damaging	Het
Ms4a6d	A	G	19: 11,601,859	S85P	probably damaging	Het
Mum1	T	A	10: 80,232,608	D195E	possibly damaging	Het
Myh4	T	A	11: 67,254,743	Y1351N	probably benign	Het
Myo16	A	G	8: 10,272,789	D73G	probably damaging	Het
Mzt1	C	T	14: 99,040,661		probably null	Het
Nalcn	G	A	14: 123,283,601	H1631Y	probably benign	Het
Ncf2	A	G	1: 152,825,910	N213S	probably benign	Het
Nf1	C	A	11: 79,547,161	T99K	probably damaging	Het
Nsf	T	C	11: 103,859,017	S547G	probably damaging	Het
Ntrk3	T	A	7: 78,462,839	I190F	probably benign	Het
Obsl1	T	C	1: 75,498,233	Y841C	probably damaging	Het
Ogdh	A	T	11: 6,340,438		probably benign	Het
Olfr1448	C	T	19: 12,919,488	V274M	probably damaging	Het
Olfr693	T	A	7: 106,678,484	M1L	probably damaging	Het
Otog	G	A	7: 46,269,343	V948I	probably damaging	Het
Plekhm1	T	C	11: 103,373,998	D880G	probably benign	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Polg	A	G	7: 79,456,493	L678S	probably benign	Het
Ptprm	C	T	17: 66,688,355	V1293I	probably damaging	Het
Rhou	A	T	8: 123,661,251	R241W	probably damaging	Het
Rtn4	A	T	11: 29,736,437	N264I	probably damaging	Het
Sez6l	T	C	5: 112,473,410		probably benign	Het
Sost	T	C	11: 101,964,243	E80G	probably damaging	Het
Spag16	C	T	1: 69,896,585		probably benign	Het
Speer4f2	A	T	5: 17,374,449	N82I	probably damaging	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
Taf1b	T	A	12: 24,556,669	L496Q	possibly damaging	Het
Tarbp1	A	G	8: 126,447,047	I976T	probably damaging	Het
Tex14	T	A	11: 87,499,605	V376D	probably damaging	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tm9sf1	T	C	14: 55,636,223	D606G	probably damaging	Het
Tmc2	A	C	2: 130,248,756	N674T	possibly damaging	Het
Top3a	C	A	11: 60,747,984	E562*	probably null	Het
Umodl1	A	T	17: 30,982,264	D389V	probably damaging	Het
Uso1	T	C	5: 92,192,859		probably benign	Het
Vmn1r205	A	G	13: 22,592,053	V293A	possibly damaging	Het
Vmn2r107	A	G	17: 20,345,578	T52A	probably benign	Het
Vmn2r4	C	T	3: 64,391,058	V461I	possibly damaging	Het
Vmn2r99	A	T	17: 19,362,153	I7F	probably benign	Het
Vps11	A	G	9: 44,359,936	F80S	probably damaging	Het
Wdr43	A	G	17: 71,633,652	S258G	probably benign	Het
Zbtb24	A	G	10: 41,451,127	D3G	probably benign	Het
Zc3hav1	C	T	6: 38,332,757	V377I	possibly damaging	Het
Zfp668	T	C	7: 127,866,482		probably null	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3195:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R8782:Csgalnact1	UTSW	8	68358655	missense	probably damaging	1.00
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTTTAAGGAGGGGCAAATAC -3'
(R):5'- AGATACTGTCTTTTCTGAACCTACC -3'

Sequencing Primer
(F):5'- GGGGCAAATACAAATGACAAATTTC -3'
(R):5'- TGAACCTACCTTTGCTTGTTTTG -3'

Posted On

2014-06-30