Incidental Mutation 'R1873:Tarbp1'
ID210946
Institutional Source Beutler Lab
Gene Symbol Tarbp1
Ensembl Gene ENSMUSG00000090290
Gene NameTAR RNA binding protein 1
SynonymsGm17296
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location126425329-126475065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126447047 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 976 (I976T)
Ref Sequence ENSEMBL: ENSMUSP00000129815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170518]
Predicted Effect probably damaging
Transcript: ENSMUST00000170518
AA Change: I976T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290
AA Change: I976T

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
low complexity region 77 97 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
SCOP:d1gw5a_ 1059 1260 3e-3 SMART
Pfam:SpoU_methylase 1421 1564 2.2e-32 PFAM
Meta Mutation Damage Score 0.3428 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Cluh C T 11: 74,662,076 A649V possibly damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gnrhr A G 5: 86,182,201 L320P probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Mark2 A G 19: 7,284,515 Y351H probably damaging Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tex14 T A 11: 87,499,605 V376D probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zc3hav1 C T 6: 38,332,757 V377I possibly damaging Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Tarbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tarbp1 APN 8 126459161 missense probably damaging 1.00
IGL01419:Tarbp1 APN 8 126428155 missense probably benign 0.03
IGL01475:Tarbp1 APN 8 126433962 missense probably benign 0.03
IGL01688:Tarbp1 APN 8 126447551 missense probably damaging 1.00
IGL01772:Tarbp1 APN 8 126447231 splice site probably benign
IGL02402:Tarbp1 APN 8 126450828 splice site probably benign
IGL02899:Tarbp1 APN 8 126453844 missense probably damaging 0.96
IGL03006:Tarbp1 APN 8 126444142 missense probably damaging 1.00
IGL03273:Tarbp1 APN 8 126453835 missense probably damaging 1.00
PIT4280001:Tarbp1 UTSW 8 126430847 missense probably damaging 0.96
R0048:Tarbp1 UTSW 8 126447530 missense probably damaging 1.00
R0309:Tarbp1 UTSW 8 126438928 splice site probably benign
R0383:Tarbp1 UTSW 8 126447484 missense probably benign 0.00
R0455:Tarbp1 UTSW 8 126440873 missense probably benign 0.00
R0738:Tarbp1 UTSW 8 126438801 critical splice donor site probably null
R1345:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1370:Tarbp1 UTSW 8 126448330 missense probably benign 0.03
R1617:Tarbp1 UTSW 8 126444268 missense possibly damaging 0.47
R1628:Tarbp1 UTSW 8 126430860 missense possibly damaging 0.78
R1702:Tarbp1 UTSW 8 126428218 missense probably damaging 1.00
R2018:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2019:Tarbp1 UTSW 8 126428114 missense probably damaging 1.00
R2060:Tarbp1 UTSW 8 126447594 splice site probably null
R2877:Tarbp1 UTSW 8 126427832 missense probably damaging 1.00
R3008:Tarbp1 UTSW 8 126447421 missense possibly damaging 0.46
R3875:Tarbp1 UTSW 8 126438799 splice site probably benign
R3905:Tarbp1 UTSW 8 126428152 missense probably damaging 1.00
R3923:Tarbp1 UTSW 8 126440771 missense probably benign 0.00
R4420:Tarbp1 UTSW 8 126447080 missense possibly damaging 0.59
R4570:Tarbp1 UTSW 8 126452233 missense probably benign 0.00
R4610:Tarbp1 UTSW 8 126474330 missense probably damaging 1.00
R4649:Tarbp1 UTSW 8 126447195 missense probably damaging 0.96
R4802:Tarbp1 UTSW 8 126474889 missense possibly damaging 0.75
R4951:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R4953:Tarbp1 UTSW 8 126447445 missense possibly damaging 0.94
R5254:Tarbp1 UTSW 8 126467156 missense probably damaging 0.96
R5255:Tarbp1 UTSW 8 126428970 missense probably benign 0.16
R5638:Tarbp1 UTSW 8 126450686 missense probably damaging 1.00
R5696:Tarbp1 UTSW 8 126447340 missense probably damaging 0.98
R5707:Tarbp1 UTSW 8 126467144 missense probably damaging 1.00
R5896:Tarbp1 UTSW 8 126452928 missense probably benign 0.05
R6087:Tarbp1 UTSW 8 126428970 missense probably benign 0.00
R6117:Tarbp1 UTSW 8 126427541 missense probably benign 0.00
R6132:Tarbp1 UTSW 8 126434809 missense probably benign 0.17
R6168:Tarbp1 UTSW 8 126448405 missense possibly damaging 0.89
R6419:Tarbp1 UTSW 8 126459044 missense possibly damaging 0.95
R6482:Tarbp1 UTSW 8 126450695 missense probably benign 0.01
R6766:Tarbp1 UTSW 8 126447400 missense probably benign 0.41
R6775:Tarbp1 UTSW 8 126436829 missense probably benign 0.16
R6960:Tarbp1 UTSW 8 126429039 missense possibly damaging 0.88
R7054:Tarbp1 UTSW 8 126474495 missense possibly damaging 0.85
R7068:Tarbp1 UTSW 8 126427034 missense probably damaging 1.00
R7454:Tarbp1 UTSW 8 126457677 missense probably benign 0.19
R7519:Tarbp1 UTSW 8 126433900 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTCCGTCCACTACAGATGG -3'
(R):5'- GGAGATTGACACTGTGTTTCTACC -3'

Sequencing Primer
(F):5'- TTCTTGTCACAGCAGCAGG -3'
(R):5'- TACCAGCTCCTGACCTCCGAG -3'
Posted On2014-06-30