Incidental Mutation 'R0122:Cyld'
ID21096
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene NameCYLD lysine 63 deubiquitinase
SynonymsCYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
MMRRC Submission 038407-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0122 (G1)
Quality Score153
Status Validated (trace)
Chromosome8
Chromosomal Location88697028-88751945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88742292 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 564 (S564P)
Ref Sequence ENSEMBL: ENSMUSP00000147904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043526
AA Change: S749P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: S749P

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098519
AA Change: S749P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: S749P

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109626
AA Change: S746P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: S746P

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209206
AA Change: S564P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209532
AA Change: S749P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209559
AA Change: S746P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209722
Predicted Effect probably benign
Transcript: ENSMUST00000211554
AA Change: S746P

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211671
Meta Mutation Damage Score 0.2026 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Adam12 T A 7: 134,012,348 I60F probably benign Het
Adamts10 A G 17: 33,528,480 probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Adamts7 A G 9: 90,179,421 E360G probably damaging Het
Atn1 A T 6: 124,743,234 probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Baz2b G T 2: 59,913,619 probably null Het
Bloc1s6 G C 2: 122,746,043 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qa T A 4: 136,897,831 T3S probably benign Het
Cacna1e A T 1: 154,443,901 F1351Y probably damaging Het
Car9 C T 4: 43,512,206 A356V probably benign Het
Ccdc116 T A 16: 17,142,734 D73V probably damaging Het
Ces2g T C 8: 104,968,300 Y518H probably damaging Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cmc1 A T 9: 118,065,320 C29S probably damaging Het
Coil T A 11: 88,985,007 probably benign Het
Col3a1 C T 1: 45,340,897 probably benign Het
Cox15 A G 19: 43,748,790 I135T possibly damaging Het
Dnah5 T A 15: 28,378,363 N2948K probably damaging Het
Dnah7a G A 1: 53,397,142 R4014W probably damaging Het
Dnmt3b T C 2: 153,676,698 Y594H probably damaging Het
Dntt A G 19: 41,053,038 K387R possibly damaging Het
Efcab7 G A 4: 99,892,363 probably benign Het
Flvcr1 G T 1: 191,021,226 P250T possibly damaging Het
Gga2 C A 7: 121,991,574 V504L probably damaging Het
Gm12239 T A 11: 56,015,912 noncoding transcript Het
Gm13089 A T 4: 143,698,404 D156E probably benign Het
Gm6327 T C 16: 12,761,026 noncoding transcript Het
Krt26 G T 11: 99,333,719 Y324* probably null Het
Lamb2 A T 9: 108,486,514 H939L probably benign Het
Lipo3 C T 19: 33,622,686 probably benign Het
Mmp1b G A 9: 7,386,689 T145M probably damaging Het
Mrps27 G T 13: 99,365,228 V76L probably benign Het
Mup6 T A 4: 60,003,995 Y29* probably null Het
Nlrc3 T C 16: 3,958,958 K756E probably damaging Het
Nnt T C 13: 119,368,597 H527R probably damaging Het
Nudt8 T C 19: 4,001,306 V59A probably benign Het
Ofcc1 A T 13: 40,280,556 probably null Het
Olfr447 T C 6: 42,911,955 V144A probably benign Het
Olfr638 T C 7: 104,003,358 W28R probably damaging Het
Olfr959 A T 9: 39,572,724 D178E probably damaging Het
Pdgfd T C 9: 6,293,851 S142P probably damaging Het
Pias4 G T 10: 81,157,087 Q22K probably damaging Het
Pin1 T C 9: 20,662,304 I95T probably benign Het
Prickle2 G A 6: 92,411,345 Q359* probably null Het
Qrich2 G T 11: 116,446,813 Q1950K possibly damaging Het
Rab10 C A 12: 3,309,357 G21V probably damaging Het
Rbm27 T A 18: 42,313,968 probably benign Het
Samd4 C A 14: 47,016,560 S160R probably benign Het
Scube3 A C 17: 28,166,528 probably benign Het
Serpinf2 A G 11: 75,436,546 L185P probably damaging Het
Slc16a12 A G 19: 34,674,864 I294T probably benign Het
Slc45a3 T A 1: 131,977,740 M167K probably damaging Het
Sspo T A 6: 48,473,976 L2673Q possibly damaging Het
Supt3 A G 17: 45,003,141 D139G probably damaging Het
Tas1r3 T C 4: 155,860,833 M644V probably benign Het
Tgfbi A G 13: 56,627,968 T276A probably damaging Het
Tmem177 T C 1: 119,910,578 I124V probably benign Het
Tmprss11f G T 5: 86,533,625 probably benign Het
Tmprss3 G A 17: 31,193,902 probably benign Het
Twf1 A G 15: 94,586,549 probably benign Het
Uba52 T A 8: 70,509,301 Q166L probably damaging Het
Ubr3 G T 2: 69,979,412 G1242V probably damaging Het
Unc13d C T 11: 116,065,482 S835N probably benign Het
Ush2a A G 1: 188,948,455 K4877E possibly damaging Het
Vmn2r98 A G 17: 19,066,400 I387V probably benign Het
Vps11 A T 9: 44,354,512 I490N probably damaging Het
Vstm4 T A 14: 32,863,811 probably null Het
Zfp110 C A 7: 12,848,597 H391N possibly damaging Het
Zfp212 C T 6: 47,931,023 P312L possibly damaging Het
Zfp329 A T 7: 12,810,987 H203Q probably damaging Het
Zscan12 G A 13: 21,368,969 G321E probably damaging Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 88705457 missense probably benign 0.41
IGL00481:Cyld APN 8 88707290 missense probably damaging 1.00
IGL01013:Cyld APN 8 88742362 missense probably damaging 1.00
IGL01653:Cyld APN 8 88741370 missense probably damaging 1.00
IGL01700:Cyld APN 8 88707099 missense probably damaging 0.99
IGL01845:Cyld APN 8 88705775 nonsense probably null
IGL02366:Cyld APN 8 88729753 missense probably damaging 1.00
IGL02379:Cyld APN 8 88744928 nonsense probably null
IGL02506:Cyld APN 8 88729590 missense possibly damaging 0.86
IGL02563:Cyld APN 8 88735894 missense probably damaging 1.00
IGL02565:Cyld APN 8 88741291 missense probably damaging 1.00
IGL02814:Cyld APN 8 88744897 missense probably benign 0.29
PIT4131001:Cyld UTSW 8 88746915 missense probably damaging 0.98
R0101:Cyld UTSW 8 88718300 critical splice donor site probably null
R0529:Cyld UTSW 8 88729759 missense probably benign 0.34
R0838:Cyld UTSW 8 88741350 missense probably benign 0.15
R1589:Cyld UTSW 8 88709990 missense possibly damaging 0.84
R1732:Cyld UTSW 8 88731667 splice site probably benign
R2029:Cyld UTSW 8 88745312 missense probably benign 0.09
R3701:Cyld UTSW 8 88729551 missense probably benign
R3798:Cyld UTSW 8 88734930 missense probably damaging 1.00
R4243:Cyld UTSW 8 88730755 nonsense probably null
R4244:Cyld UTSW 8 88730755 nonsense probably null
R4260:Cyld UTSW 8 88741391 missense probably damaging 1.00
R4458:Cyld UTSW 8 88719301 missense probably benign 0.24
R4551:Cyld UTSW 8 88707134 missense possibly damaging 0.95
R4718:Cyld UTSW 8 88742305 missense probably damaging 0.99
R4735:Cyld UTSW 8 88729650 missense probably damaging 1.00
R4753:Cyld UTSW 8 88744816 splice site probably null
R4966:Cyld UTSW 8 88742301 missense possibly damaging 0.55
R4975:Cyld UTSW 8 88707232 missense probably benign
R5375:Cyld UTSW 8 88733036 missense possibly damaging 0.77
R5647:Cyld UTSW 8 88734926 missense probably benign 0.10
R5741:Cyld UTSW 8 88744846 missense probably damaging 1.00
R5837:Cyld UTSW 8 88741404 missense probably damaging 0.99
R5931:Cyld UTSW 8 88729842 splice site probably null
R5970:Cyld UTSW 8 88732993 missense probably damaging 0.99
R5992:Cyld UTSW 8 88733053 missense probably damaging 1.00
R6165:Cyld UTSW 8 88746933 missense possibly damaging 0.88
R7135:Cyld UTSW 8 88744892 missense possibly damaging 0.93
R7667:Cyld UTSW 8 88742302 missense probably benign 0.01
R7858:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7912:Cyld UTSW 8 88734897 missense probably damaging 1.00
R7941:Cyld UTSW 8 88709988 missense probably damaging 0.98
R7993:Cyld UTSW 8 88734897 missense probably damaging 1.00
RF016:Cyld UTSW 8 88705441 nonsense probably null
X0010:Cyld UTSW 8 88746912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGAAACTACTGCTGGGAGTGAC -3'
(R):5'- CCAAGCTCTTCAGGTACTGCACTG -3'

Sequencing Primer
(F):5'- AGCTGTGACTACTTCAGTTTCAGAG -3'
(R):5'- GTACTGCACTGCATGTCAAAG -3'
Posted On2013-04-11