Incidental Mutation 'R1873:Tex14'
ID210961
Institutional Source Beutler Lab
Gene Symbol Tex14
Ensembl Gene ENSMUSG00000010342
Gene Nametestis expressed gene 14
Synonyms
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87405065-87555823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87499605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 376 (V376D)
Ref Sequence ENSEMBL: ENSMUSP00000054444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060835]
Predicted Effect probably damaging
Transcript: ENSMUST00000060835
AA Change: V376D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342
AA Change: V376D

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Meta Mutation Damage Score 0.5671 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted allele are infertile due to spermatogenic failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Cluh C T 11: 74,662,076 A649V possibly damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gnrhr A G 5: 86,182,201 L320P probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Mark2 A G 19: 7,284,515 Y351H probably damaging Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tarbp1 A G 8: 126,447,047 I976T probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zc3hav1 C T 6: 38,332,757 V377I possibly damaging Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Tex14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tex14 APN 11 87535643 missense probably damaging 0.98
IGL00494:Tex14 APN 11 87555484 missense probably damaging 1.00
IGL01604:Tex14 APN 11 87509698 missense possibly damaging 0.63
IGL02690:Tex14 APN 11 87486274 missense probably benign 0.11
IGL02888:Tex14 APN 11 87527912 critical splice donor site probably null
IGL03073:Tex14 APN 11 87535609 missense probably damaging 0.99
IGL03109:Tex14 APN 11 87543365 missense probably damaging 1.00
IGL03047:Tex14 UTSW 11 87536704 missense probably damaging 1.00
R0141:Tex14 UTSW 11 87493031 splice site probably null
R0455:Tex14 UTSW 11 87514305 missense possibly damaging 0.93
R0624:Tex14 UTSW 11 87520699 missense probably benign 0.19
R0718:Tex14 UTSW 11 87499613 missense probably benign 0.20
R1077:Tex14 UTSW 11 87519745 splice site probably benign
R1118:Tex14 UTSW 11 87522517 missense probably benign 0.07
R1120:Tex14 UTSW 11 87538676 splice site probably benign
R1168:Tex14 UTSW 11 87536742 missense probably benign 0.11
R1190:Tex14 UTSW 11 87495108 intron probably null
R1470:Tex14 UTSW 11 87549529 splice site probably benign
R1563:Tex14 UTSW 11 87536808 missense probably damaging 0.99
R1607:Tex14 UTSW 11 87554928 missense probably damaging 1.00
R1696:Tex14 UTSW 11 87511545 missense possibly damaging 0.49
R1894:Tex14 UTSW 11 87474448 missense probably damaging 1.00
R1911:Tex14 UTSW 11 87495035 missense probably damaging 1.00
R1955:Tex14 UTSW 11 87509621 missense probably damaging 1.00
R1971:Tex14 UTSW 11 87511605 missense probably damaging 1.00
R1990:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1991:Tex14 UTSW 11 87549470 missense probably damaging 1.00
R1993:Tex14 UTSW 11 87536755 missense possibly damaging 0.57
R2106:Tex14 UTSW 11 87486250 missense possibly damaging 0.47
R2118:Tex14 UTSW 11 87519743 splice site probably benign
R2860:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R2861:Tex14 UTSW 11 87474417 missense probably damaging 1.00
R4016:Tex14 UTSW 11 87538623 unclassified probably null
R4089:Tex14 UTSW 11 87512203 missense probably damaging 1.00
R4158:Tex14 UTSW 11 87516769 missense probably benign 0.06
R4533:Tex14 UTSW 11 87536829 nonsense probably null
R4713:Tex14 UTSW 11 87536865 missense probably damaging 0.99
R4758:Tex14 UTSW 11 87514485 missense probably benign 0.00
R4880:Tex14 UTSW 11 87486295 missense possibly damaging 0.95
R4953:Tex14 UTSW 11 87536901 critical splice donor site probably null
R5092:Tex14 UTSW 11 87514842 missense probably benign 0.03
R5119:Tex14 UTSW 11 87433813 missense probably damaging 1.00
R5322:Tex14 UTSW 11 87511472 missense probably benign 0.04
R5470:Tex14 UTSW 11 87551604 missense probably damaging 0.99
R5607:Tex14 UTSW 11 87522578 missense probably benign 0.00
R5642:Tex14 UTSW 11 87514220 missense probably benign
R5643:Tex14 UTSW 11 87535626 missense probably damaging 1.00
R5786:Tex14 UTSW 11 87514295 missense probably damaging 0.97
R6478:Tex14 UTSW 11 87514373 missense probably benign
R6560:Tex14 UTSW 11 87497862 missense possibly damaging 0.95
R6661:Tex14 UTSW 11 87495016 missense probably damaging 1.00
R7037:Tex14 UTSW 11 87497915 missense probably damaging 1.00
R7156:Tex14 UTSW 11 87484719 missense probably damaging 0.99
R7465:Tex14 UTSW 11 87514430 missense possibly damaging 0.48
R7675:Tex14 UTSW 11 87509678 missense probably damaging 1.00
R7725:Tex14 UTSW 11 87495042 missense probably damaging 0.99
X0017:Tex14 UTSW 11 87535549 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCACCTGTAGGAAAGGAGC -3'
(R):5'- ATGGACAGTTTCCCATCAATCAC -3'

Sequencing Primer
(F):5'- GGCTCCTGTCTGCTAAATGAGAAAC -3'
(R):5'- CATGTCCTGAACAGATTGAGTGTCAG -3'
Posted On2014-06-30