Incidental Mutation 'R1873:Umodl1'
ID 210980
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 039895-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1873 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31201238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 389 (D389V)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: D389V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: D389V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: D389V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: D389V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: D389V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: D389V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,870,781 (GRCm39) I124L probably benign Het
Abi3bp A G 16: 56,394,862 (GRCm39) Y190C probably damaging Het
Adam34 A C 8: 44,104,843 (GRCm39) N267K probably benign Het
Anxa5 T C 3: 36,503,551 (GRCm39) D301G probably damaging Het
Atf7ip G T 6: 136,536,886 (GRCm39) D40Y probably damaging Het
Cacna2d2 T G 9: 107,391,071 (GRCm39) M400R probably damaging Het
Cd96 C A 16: 45,938,335 (GRCm39) L43F probably damaging Het
Cep120 T C 18: 53,871,560 (GRCm39) E104G probably damaging Het
Cfap221 T C 1: 119,881,389 (GRCm39) I358V probably benign Het
Cfhr4 C T 1: 139,702,398 (GRCm39) E29K probably damaging Het
Chil4 C T 3: 106,113,414 (GRCm39) E168K probably benign Het
Clca3a1 A G 3: 144,452,590 (GRCm39) V631A probably damaging Het
Cluh C T 11: 74,552,902 (GRCm39) A649V possibly damaging Het
Commd9 A G 2: 101,727,502 (GRCm39) T99A probably benign Het
Csgalnact1 T C 8: 68,854,036 (GRCm39) N255S probably benign Het
Cyth3 T A 5: 143,683,516 (GRCm39) H138Q possibly damaging Het
Dnah7a A T 1: 53,495,691 (GRCm39) probably benign Het
Fbxl18 G A 5: 142,871,978 (GRCm39) A419V probably damaging Het
Fyco1 A G 9: 123,652,303 (GRCm39) V1135A probably benign Het
Glcci1 C A 6: 8,537,837 (GRCm39) H152N probably benign Het
Gm10477 T A X: 55,570,127 (GRCm39) F9Y probably damaging Het
Gnrhr A G 5: 86,330,060 (GRCm39) L320P probably damaging Het
Gorasp1 A T 9: 119,759,306 (GRCm39) S138T probably benign Het
Hars1 C A 18: 36,900,294 (GRCm39) Q469H probably damaging Het
Homer2 T C 7: 81,286,111 (GRCm39) K34E probably damaging Het
Hscb T C 5: 110,978,823 (GRCm39) I198V probably benign Het
Kat6b T C 14: 21,567,057 (GRCm39) S39P probably damaging Het
Kcnk12 G T 17: 88,053,499 (GRCm39) Q388K probably damaging Het
Kcnq3 A G 15: 65,874,104 (GRCm39) I548T probably benign Het
Mark2 A G 19: 7,261,880 (GRCm39) Y351H probably damaging Het
Masp2 A T 4: 148,698,952 (GRCm39) I678F probably damaging Het
Mc4r A T 18: 66,992,531 (GRCm39) I194N probably damaging Het
Ms4a6d A G 19: 11,579,223 (GRCm39) S85P probably damaging Het
Myh4 T A 11: 67,145,569 (GRCm39) Y1351N probably benign Het
Myo16 A G 8: 10,322,789 (GRCm39) D73G probably damaging Het
Mzt1 C T 14: 99,278,097 (GRCm39) probably null Het
Nalcn G A 14: 123,521,013 (GRCm39) H1631Y probably benign Het
Ncf2 A G 1: 152,701,661 (GRCm39) N213S probably benign Het
Nf1 C A 11: 79,437,987 (GRCm39) T99K probably damaging Het
Nsf T C 11: 103,749,843 (GRCm39) S547G probably damaging Het
Ntrk3 T A 7: 78,112,587 (GRCm39) I190F probably benign Het
Obsl1 T C 1: 75,474,877 (GRCm39) Y841C probably damaging Het
Ogdh A T 11: 6,290,438 (GRCm39) probably benign Het
Or2ag12 T A 7: 106,277,691 (GRCm39) M1L probably damaging Het
Or5b12 C T 19: 12,896,852 (GRCm39) V274M probably damaging Het
Otog G A 7: 45,918,767 (GRCm39) V948I probably damaging Het
Plekhm1 T C 11: 103,264,824 (GRCm39) D880G probably benign Het
Pnliprp2 G T 19: 58,751,821 (GRCm39) V189L probably benign Het
Polg A G 7: 79,106,241 (GRCm39) L678S probably benign Het
Ptprm C T 17: 66,995,350 (GRCm39) V1293I probably damaging Het
Pwwp3a T A 10: 80,068,442 (GRCm39) D195E possibly damaging Het
Rhou A T 8: 124,387,990 (GRCm39) R241W probably damaging Het
Rtn4 A T 11: 29,686,437 (GRCm39) N264I probably damaging Het
Sez6l T C 5: 112,621,276 (GRCm39) probably benign Het
Sost T C 11: 101,855,069 (GRCm39) E80G probably damaging Het
Spag16 C T 1: 69,935,744 (GRCm39) probably benign Het
Speer4f2 A T 5: 17,579,447 (GRCm39) N82I probably damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Taf1b T A 12: 24,606,668 (GRCm39) L496Q possibly damaging Het
Tarbp1 A G 8: 127,173,786 (GRCm39) I976T probably damaging Het
Tex14 T A 11: 87,390,431 (GRCm39) V376D probably damaging Het
Timm21 G C 18: 84,967,387 (GRCm39) L130V probably damaging Het
Tm9sf1 T C 14: 55,873,680 (GRCm39) D606G probably damaging Het
Tmc2 A C 2: 130,090,676 (GRCm39) N674T possibly damaging Het
Top3a C A 11: 60,638,810 (GRCm39) E562* probably null Het
Uso1 T C 5: 92,340,718 (GRCm39) probably benign Het
Vmn1r205 A G 13: 22,776,223 (GRCm39) V293A possibly damaging Het
Vmn2r107 A G 17: 20,565,840 (GRCm39) T52A probably benign Het
Vmn2r4 C T 3: 64,298,479 (GRCm39) V461I possibly damaging Het
Vmn2r99 A T 17: 19,582,415 (GRCm39) I7F probably benign Het
Vps11 A G 9: 44,271,233 (GRCm39) F80S probably damaging Het
Wdr43 A G 17: 71,940,647 (GRCm39) S258G probably benign Het
Zbtb24 A G 10: 41,327,123 (GRCm39) D3G probably benign Het
Zc3hav1 C T 6: 38,309,692 (GRCm39) V377I possibly damaging Het
Zfp668 T C 7: 127,465,654 (GRCm39) probably null Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCAGTGTTACCATTCCTTG -3'
(R):5'- TGCGTCCTTGTTCCGAGTAC -3'

Sequencing Primer
(F):5'- GTCAGTGTTACCATTCCTTGTATAG -3'
(R):5'- TCCGAGTACTTGAGGGCAG -3'
Posted On 2014-06-30