Mutagenetix > Incidental Mutation

Incidental Mutation 'R1874:Irs1'

210995

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

039896-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.647) question?

Stock #

R1874 (G1)

Quality Score

108

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TTCTCTGAGTGGCCACAGCGTCT to TTCT at 82289853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069799

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 94.1%

Validation Efficiency

96% (105/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,742,691	S217G	probably benign	Het
Adrb3	C	A	8: 27,227,563	R286L	probably damaging	Het
Akap11	T	A	14: 78,511,866	D1027V	probably benign	Het
Ank3	A	T	10: 69,898,083	I726F	probably damaging	Het
Ankmy2	T	A	12: 36,165,931	D43E	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,556	D432G	probably damaging	Het
Ano3	A	C	2: 110,884,872	S74A	probably benign	Het
B4galnt4	T	A	7: 141,070,526	S769T	probably damaging	Het
Bicral	T	A	17: 46,825,178	T369S	probably benign	Het
Blm	A	G	7: 80,497,418	L738P	probably damaging	Het
Bpifb3	A	G	2: 153,925,840	T278A	probably benign	Het
Bpifb5	A	G	2: 154,227,202		probably benign	Het
Brd8	G	C	18: 34,610,474	P266R	probably damaging	Het
Btaf1	A	T	19: 36,980,583	M587L	probably benign	Het
Casz1	C	G	4: 148,943,211	T1015S	probably damaging	Het
Cdh23	A	G	10: 60,436,818	I524T	possibly damaging	Het
Celsr3	T	C	9: 108,835,838	V1825A	probably benign	Het
Cenpf	A	G	1: 189,683,816	L104P	probably damaging	Het
Clasp1	G	T	1: 118,600,585		probably null	Het
Coprs	A	G	8: 13,885,112	W148R	probably damaging	Het
Cpne1	A	G	2: 156,078,382	S168P	probably damaging	Het
Cpxm2	T	C	7: 132,059,834	Y408C	probably damaging	Het
Ctnna3	A	G	10: 63,504,107	E24G	possibly damaging	Het
Cubn	T	A	2: 13,323,002	S2671C	probably damaging	Het
Cyp4f39	T	A	17: 32,483,324	F265Y	probably damaging	Het
Dgkq	C	A	5: 108,660,595	R34L	probably benign	Het
Dnajc7	C	T	11: 100,599,313		probably benign	Het
Eml6	T	G	11: 29,831,136	D632A	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fbxw22	A	T	9: 109,385,111	C212*	probably null	Het
Ffar2	A	G	7: 30,819,414		probably null	Het
Fga	A	T	3: 83,032,721	T561S	probably damaging	Het
Fry	A	G	5: 150,345,921	Y159C	probably damaging	Het
Gal3st1	A	G	11: 3,998,231	Y146C	probably damaging	Het
Gapvd1	A	T	2: 34,706,021	H788Q	probably damaging	Het
Gimap7	G	A	6: 48,723,515	V12I	possibly damaging	Het
Gli2	C	A	1: 119,002,049	A43S	possibly damaging	Het
Gm15446	T	C	5: 109,942,553	F224L	probably damaging	Het
Gm21738	C	T	14: 19,418,824	V35I	possibly damaging	Het
Grhl1	T	C	12: 24,586,156		probably benign	Het
Grk6	T	C	13: 55,450,273	Y53H	probably damaging	Het
Hcar1	C	T	5: 123,879,265	R121K	probably damaging	Het
Hmcn1	A	C	1: 150,720,695	S1797A	probably damaging	Het
Hsd17b7	A	T	1: 169,955,993	L282Q	possibly damaging	Het
Kif1b	C	T	4: 149,187,632	V1571I	probably benign	Het
Lpl	T	A	8: 68,896,619	C266S	probably damaging	Het
Mag	G	A	7: 30,909,051	H213Y	probably benign	Het
Mansc4	T	G	6: 147,075,190	R309S	probably benign	Het
Mlh3	A	G	12: 85,237,513		probably null	Het
Mndal	G	A	1: 173,860,367		probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Myh3	A	G	11: 67,093,179	I990V	probably benign	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Naa16	T	C	14: 79,355,743	E463G	possibly damaging	Het
Nadsyn1	A	G	7: 143,797,844	F684S	probably damaging	Het
Notch1	T	C	2: 26,481,579	E286G	possibly damaging	Het
Nynrin	A	T	14: 55,863,493	I247L	probably benign	Het
Olfr136	C	T	17: 38,335,969	P271S	probably damaging	Het
Olfr644	T	C	7: 104,068,129	I301V	probably null	Het
Olfr981	T	A	9: 40,022,855	I154N	possibly damaging	Het
Oprm1	A	G	10: 6,789,035	H54R	probably benign	Het
P4hb	C	T	11: 120,562,166	D483N	probably benign	Het
Pak1	T	C	7: 97,871,580	S149P	probably benign	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pih1d2	A	G	9: 50,620,945	M88V	possibly damaging	Het
Pms1	A	T	1: 53,207,233	N382K	probably benign	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Pot1b	T	A	17: 55,654,805	Q591L	probably benign	Het
Ppp1r9a	C	T	6: 4,906,348	T301M	possibly damaging	Het
Psg21	T	C	7: 18,650,816	E335G	probably benign	Het
Ptpru	T	A	4: 131,769,755	M1416L	probably benign	Het
Pxn	T	C	5: 115,544,990	V117A	probably damaging	Het
Qsox1	C	T	1: 155,812,639	R54H	possibly damaging	Het
Rad1	A	G	15: 10,488,006	E42G	probably damaging	Het
Rpp14	A	G	14: 8,090,145	Y23C	probably benign	Het
Sdk2	C	T	11: 113,834,956	V1156I	probably benign	Het
Serpina3j	G	T	12: 104,319,699	R371L	probably benign	Het
Serpinb9d	T	A	13: 33,197,963		probably null	Het
Sirt5	C	T	13: 43,370,791	S13F	possibly damaging	Het
Slc6a7	T	A	18: 61,001,398		probably benign	Het
Slx4	A	G	16: 3,986,848	S701P	probably benign	Het
Snx29	A	G	16: 11,367,681	T43A	probably benign	Het
Speg	T	C	1: 75,423,906	V2570A	probably benign	Het
Srrm4	T	A	5: 116,453,506		probably benign	Het
Stk32a	A	G	18: 43,261,316	Y110C	probably damaging	Het
Tbc1d31	G	A	15: 57,916,110	G73E	probably benign	Het
Thsd7a	A	T	6: 12,555,435	I150N	possibly damaging	Het
Tjp1	A	T	7: 65,319,253	D699E	probably damaging	Het
Tmem143	A	G	7: 45,916,564	D437G	possibly damaging	Het
Tmem45a2	A	G	16: 57,047,084	Y85H	possibly damaging	Het
Tmem45b	T	A	9: 31,429,087	T7S	probably damaging	Het
Ube4b	A	G	4: 149,347,971	L832P	probably damaging	Het
Ugp2	G	T	11: 21,329,048	F379L	probably damaging	Het
Ugt3a2	A	T	15: 9,365,351	D350V	probably damaging	Het
Vmn2r8	T	A	5: 108,802,418	T188S	possibly damaging	Het
Vwa7	C	G	17: 35,017,112	P14R	probably benign	Het
Vwc2	C	A	11: 11,261,495	T317K	probably damaging	Het
Vwf	A	T	6: 125,628,372	Q906L	probably benign	Het
Wdr49	A	G	3: 75,429,347	V351A	probably damaging	Het
Wdr7	A	G	18: 63,728,504	S196G	probably benign	Het
Xkr6	C	A	14: 63,798,296	A26E	unknown	Het
Zcchc11	T	A	4: 108,550,725	V1397D	probably damaging	Het
Zfp955b	T	C	17: 33,305,453	I47V	probably benign	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
R9591:Irs1	UTSW	1	82288248	missense	probably benign	0.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TTCGAGATCTCCGAGTCAGTCC -3'
(R):5'- AGGAGGTCTGGCAGGTTATC -3'

Sequencing Primer
(F):5'- TCCGAGTCAGTCCCACCTG -3'
(R):5'- GGTTATCCTGAAACCCAAGGGC -3'

Posted On

2014-06-30