Mutagenetix > Incidental Mutation

Incidental Mutation 'R1874:Cubn'

211005

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

039896-MU

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13323002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 2671 (S2671C)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: S2671C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: S2671C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149137

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 94.1%

Validation Efficiency

96% (105/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,742,691	S217G	probably benign	Het
Adrb3	C	A	8: 27,227,563	R286L	probably damaging	Het
Akap11	T	A	14: 78,511,866	D1027V	probably benign	Het
Ank3	A	T	10: 69,898,083	I726F	probably damaging	Het
Ankmy2	T	A	12: 36,165,931	D43E	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,556	D432G	probably damaging	Het
Ano3	A	C	2: 110,884,872	S74A	probably benign	Het
B4galnt4	T	A	7: 141,070,526	S769T	probably damaging	Het
Bicral	T	A	17: 46,825,178	T369S	probably benign	Het
Blm	A	G	7: 80,497,418	L738P	probably damaging	Het
Bpifb3	A	G	2: 153,925,840	T278A	probably benign	Het
Bpifb5	A	G	2: 154,227,202		probably benign	Het
Brd8	G	C	18: 34,610,474	P266R	probably damaging	Het
Btaf1	A	T	19: 36,980,583	M587L	probably benign	Het
Casz1	C	G	4: 148,943,211	T1015S	probably damaging	Het
Cdh23	A	G	10: 60,436,818	I524T	possibly damaging	Het
Celsr3	T	C	9: 108,835,838	V1825A	probably benign	Het
Cenpf	A	G	1: 189,683,816	L104P	probably damaging	Het
Clasp1	G	T	1: 118,600,585		probably null	Het
Coprs	A	G	8: 13,885,112	W148R	probably damaging	Het
Cpne1	A	G	2: 156,078,382	S168P	probably damaging	Het
Cpxm2	T	C	7: 132,059,834	Y408C	probably damaging	Het
Ctnna3	A	G	10: 63,504,107	E24G	possibly damaging	Het
Cyp4f39	T	A	17: 32,483,324	F265Y	probably damaging	Het
Dgkq	C	A	5: 108,660,595	R34L	probably benign	Het
Dnajc7	C	T	11: 100,599,313		probably benign	Het
Eml6	T	G	11: 29,831,136	D632A	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fbxw22	A	T	9: 109,385,111	C212*	probably null	Het
Ffar2	A	G	7: 30,819,414		probably null	Het
Fga	A	T	3: 83,032,721	T561S	probably damaging	Het
Fry	A	G	5: 150,345,921	Y159C	probably damaging	Het
Gal3st1	A	G	11: 3,998,231	Y146C	probably damaging	Het
Gapvd1	A	T	2: 34,706,021	H788Q	probably damaging	Het
Gimap7	G	A	6: 48,723,515	V12I	possibly damaging	Het
Gli2	C	A	1: 119,002,049	A43S	possibly damaging	Het
Gm15446	T	C	5: 109,942,553	F224L	probably damaging	Het
Gm21738	C	T	14: 19,418,824	V35I	possibly damaging	Het
Grhl1	T	C	12: 24,586,156		probably benign	Het
Grk6	T	C	13: 55,450,273	Y53H	probably damaging	Het
Hcar1	C	T	5: 123,879,265	R121K	probably damaging	Het
Hmcn1	A	C	1: 150,720,695	S1797A	probably damaging	Het
Hsd17b7	A	T	1: 169,955,993	L282Q	possibly damaging	Het
Irs1	TTCTCTGAGTGGCCACAGCGTCT	TTCT	1: 82,289,853		probably null	Het
Kif1b	C	T	4: 149,187,632	V1571I	probably benign	Het
Lpl	T	A	8: 68,896,619	C266S	probably damaging	Het
Mag	G	A	7: 30,909,051	H213Y	probably benign	Het
Mansc4	T	G	6: 147,075,190	R309S	probably benign	Het
Mlh3	A	G	12: 85,237,513		probably null	Het
Mndal	G	A	1: 173,860,367		probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Myh3	A	G	11: 67,093,179	I990V	probably benign	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Naa16	T	C	14: 79,355,743	E463G	possibly damaging	Het
Nadsyn1	A	G	7: 143,797,844	F684S	probably damaging	Het
Notch1	T	C	2: 26,481,579	E286G	possibly damaging	Het
Nynrin	A	T	14: 55,863,493	I247L	probably benign	Het
Olfr136	C	T	17: 38,335,969	P271S	probably damaging	Het
Olfr644	T	C	7: 104,068,129	I301V	probably null	Het
Olfr981	T	A	9: 40,022,855	I154N	possibly damaging	Het
Oprm1	A	G	10: 6,789,035	H54R	probably benign	Het
P4hb	C	T	11: 120,562,166	D483N	probably benign	Het
Pak1	T	C	7: 97,871,580	S149P	probably benign	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pih1d2	A	G	9: 50,620,945	M88V	possibly damaging	Het
Pms1	A	T	1: 53,207,233	N382K	probably benign	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Pot1b	T	A	17: 55,654,805	Q591L	probably benign	Het
Ppp1r9a	C	T	6: 4,906,348	T301M	possibly damaging	Het
Psg21	T	C	7: 18,650,816	E335G	probably benign	Het
Ptpru	T	A	4: 131,769,755	M1416L	probably benign	Het
Pxn	T	C	5: 115,544,990	V117A	probably damaging	Het
Qsox1	C	T	1: 155,812,639	R54H	possibly damaging	Het
Rad1	A	G	15: 10,488,006	E42G	probably damaging	Het
Rpp14	A	G	14: 8,090,145	Y23C	probably benign	Het
Sdk2	C	T	11: 113,834,956	V1156I	probably benign	Het
Serpina3j	G	T	12: 104,319,699	R371L	probably benign	Het
Serpinb9d	T	A	13: 33,197,963		probably null	Het
Sirt5	C	T	13: 43,370,791	S13F	possibly damaging	Het
Slc6a7	T	A	18: 61,001,398		probably benign	Het
Slx4	A	G	16: 3,986,848	S701P	probably benign	Het
Snx29	A	G	16: 11,367,681	T43A	probably benign	Het
Speg	T	C	1: 75,423,906	V2570A	probably benign	Het
Srrm4	T	A	5: 116,453,506		probably benign	Het
Stk32a	A	G	18: 43,261,316	Y110C	probably damaging	Het
Tbc1d31	G	A	15: 57,916,110	G73E	probably benign	Het
Thsd7a	A	T	6: 12,555,435	I150N	possibly damaging	Het
Tjp1	A	T	7: 65,319,253	D699E	probably damaging	Het
Tmem143	A	G	7: 45,916,564	D437G	possibly damaging	Het
Tmem45a2	A	G	16: 57,047,084	Y85H	possibly damaging	Het
Tmem45b	T	A	9: 31,429,087	T7S	probably damaging	Het
Ube4b	A	G	4: 149,347,971	L832P	probably damaging	Het
Ugp2	G	T	11: 21,329,048	F379L	probably damaging	Het
Ugt3a2	A	T	15: 9,365,351	D350V	probably damaging	Het
Vmn2r8	T	A	5: 108,802,418	T188S	possibly damaging	Het
Vwa7	C	G	17: 35,017,112	P14R	probably benign	Het
Vwc2	C	A	11: 11,261,495	T317K	probably damaging	Het
Vwf	A	T	6: 125,628,372	Q906L	probably benign	Het
Wdr49	A	G	3: 75,429,347	V351A	probably damaging	Het
Wdr7	A	G	18: 63,728,504	S196G	probably benign	Het
Xkr6	C	A	14: 63,798,296	A26E	unknown	Het
Zcchc11	T	A	4: 108,550,725	V1397D	probably damaging	Het
Zfp955b	T	C	17: 33,305,453	I47V	probably benign	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13468852	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13440514	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13427835	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13342498	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13351003	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13287064	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13383959	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13308566	nonsense	probably null
R8874:Cubn	UTSW	2	13360346	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13456655	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13287103	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13332465	splice site	probably benign
R9261:Cubn	UTSW	2	13278451	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13381892	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13458956	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13287699	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13478134	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13321180	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13314718	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13428719	missense	probably benign
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACCATAAGAATATAGTGGGGTCTCC -3'
(R):5'- AATGCCTGCTACTGTACCAGG -3'

Sequencing Primer
(F):5'- gggtctccagaataaaggaaa -3'
(R):5'- CAGGATTGAAATAAATCAAGAAGTGC -3'

Posted On

2014-06-30