Incidental Mutation 'R1874:Notch1'
ID 211006
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Name notch 1
Synonyms Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 26457903-26516663 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26481579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 286 (E286G)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
AlphaFold Q01705
PDB Structure The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028288
AA Change: E286G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: E286G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Meta Mutation Damage Score 0.2384 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
R7379:Notch1 UTSW 2 26479467 missense probably damaging 1.00
R7560:Notch1 UTSW 2 26460165 missense probably benign 0.43
R7610:Notch1 UTSW 2 26478179 missense probably benign 0.13
R7833:Notch1 UTSW 2 26459533 makesense probably null
R7988:Notch1 UTSW 2 26471001 missense probably benign 0.00
R8493:Notch1 UTSW 2 26472239 missense unknown
R8514:Notch1 UTSW 2 26472169 missense probably damaging 1.00
R8523:Notch1 UTSW 2 26464905 missense possibly damaging 0.82
R8677:Notch1 UTSW 2 26469924 missense probably damaging 1.00
R8696:Notch1 UTSW 2 26477992 critical splice acceptor site probably benign
R8833:Notch1 UTSW 2 26481603 missense probably damaging 1.00
R8964:Notch1 UTSW 2 26481050 missense possibly damaging 0.65
R9091:Notch1 UTSW 2 26479883 missense probably damaging 0.99
R9144:Notch1 UTSW 2 26459575 missense probably benign 0.00
R9145:Notch1 UTSW 2 26459575 missense probably benign 0.00
R9151:Notch1 UTSW 2 26477927 missense probably benign 0.01
R9270:Notch1 UTSW 2 26479883 missense probably damaging 0.99
R9463:Notch1 UTSW 2 26469833 missense probably benign 0.20
R9546:Notch1 UTSW 2 26481115 missense probably damaging 0.97
R9674:Notch1 UTSW 2 26471296 missense probably damaging 0.98
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Z1177:Notch1 UTSW 2 26460309 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGACTCCAACTGGAAGCACAG -3'
(R):5'- AGAGCAGAACATTGCAGGTCC -3'

Sequencing Primer
(F):5'- AGCACAGAAGCTGCTGC -3'
(R):5'- TTGCAGGTCCACCCAGAATCTG -3'
Posted On 2014-06-30