Incidental Mutation 'R1874:Kif1b'
ID 211020
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Name kinesin family member 1B
Synonyms Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 039896-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 149176319-149307693 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 149187632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1571 (V1571I)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
AlphaFold Q60575
Predicted Effect probably benign
Transcript: ENSMUST00000055647
AA Change: V1525I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: V1525I

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060537
AA Change: V1571I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: V1571I

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139123
AA Change: V249I
SMART Domains Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077
AA Change: V249I

DomainStartEndE-ValueType
Pfam:DUF3694 1 92 4.4e-23 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 204 232 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
PH 381 480 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150853
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 (GRCm38) S217G probably benign Het
Adrb3 C A 8: 27,227,563 (GRCm38) R286L probably damaging Het
Akap11 T A 14: 78,511,866 (GRCm38) D1027V probably benign Het
Ank3 A T 10: 69,898,083 (GRCm38) I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 (GRCm38) D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 (GRCm38) D432G probably damaging Het
Ano3 A C 2: 110,884,872 (GRCm38) S74A probably benign Het
B4galnt4 T A 7: 141,070,526 (GRCm38) S769T probably damaging Het
Bicral T A 17: 46,825,178 (GRCm38) T369S probably benign Het
Blm A G 7: 80,497,418 (GRCm38) L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 (GRCm38) T278A probably benign Het
Bpifb5 A G 2: 154,227,202 (GRCm38) probably benign Het
Brd8 G C 18: 34,610,474 (GRCm38) P266R probably damaging Het
Btaf1 A T 19: 36,980,583 (GRCm38) M587L probably benign Het
Casz1 C G 4: 148,943,211 (GRCm38) T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 (GRCm38) I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 (GRCm38) V1825A probably benign Het
Cenpf A G 1: 189,683,816 (GRCm38) L104P probably damaging Het
Clasp1 G T 1: 118,600,585 (GRCm38) probably null Het
Coprs A G 8: 13,885,112 (GRCm38) W148R probably damaging Het
Cpne1 A G 2: 156,078,382 (GRCm38) S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 (GRCm38) Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 (GRCm38) E24G possibly damaging Het
Cubn T A 2: 13,323,002 (GRCm38) S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 (GRCm38) F265Y probably damaging Het
Dgkq C A 5: 108,660,595 (GRCm38) R34L probably benign Het
Dnajc7 C T 11: 100,599,313 (GRCm38) probably benign Het
Eml6 T G 11: 29,831,136 (GRCm38) D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 (GRCm38) A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 (GRCm38) C212* probably null Het
Ffar2 A G 7: 30,819,414 (GRCm38) probably null Het
Fga A T 3: 83,032,721 (GRCm38) T561S probably damaging Het
Fry A G 5: 150,345,921 (GRCm38) Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 (GRCm38) Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 (GRCm38) H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 (GRCm38) V12I possibly damaging Het
Gli2 C A 1: 119,002,049 (GRCm38) A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 (GRCm38) F224L probably damaging Het
Gm21738 C T 14: 19,418,824 (GRCm38) V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 (GRCm38) probably benign Het
Grk6 T C 13: 55,450,273 (GRCm38) Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 (GRCm38) R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 (GRCm38) S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 (GRCm38) L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 (GRCm38) probably null Het
Lpl T A 8: 68,896,619 (GRCm38) C266S probably damaging Het
Mag G A 7: 30,909,051 (GRCm38) H213Y probably benign Het
Mansc4 T G 6: 147,075,190 (GRCm38) R309S probably benign Het
Mlh3 A G 12: 85,237,513 (GRCm38) probably null Het
Mndal G A 1: 173,860,367 (GRCm38) probably benign Het
Mrgpra2b T A 7: 47,463,994 (GRCm38) E330V probably damaging Het
Myh3 A G 11: 67,093,179 (GRCm38) I990V probably benign Het
Myoz2 A T 3: 123,026,116 (GRCm38) S65T probably damaging Het
Naa16 T C 14: 79,355,743 (GRCm38) E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 (GRCm38) F684S probably damaging Het
Notch1 T C 2: 26,481,579 (GRCm38) E286G possibly damaging Het
Nynrin A T 14: 55,863,493 (GRCm38) I247L probably benign Het
Oprm1 A G 10: 6,789,035 (GRCm38) H54R probably benign Het
Or10g6 T A 9: 40,022,855 (GRCm38) I154N possibly damaging Het
Or2n1d C T 17: 38,335,969 (GRCm38) P271S probably damaging Het
Or51a43 T C 7: 104,068,129 (GRCm38) I301V probably null Het
P4hb C T 11: 120,562,166 (GRCm38) D483N probably benign Het
Pak1 T C 7: 97,871,580 (GRCm38) S149P probably benign Het
Pars2 T C 4: 106,653,716 (GRCm38) F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 (GRCm38) M88V possibly damaging Het
Pms1 A T 1: 53,207,233 (GRCm38) N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 (GRCm38) V189L probably benign Het
Pole G A 5: 110,323,664 (GRCm38) V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 (GRCm38) Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 (GRCm38) T301M possibly damaging Het
Psg21 T C 7: 18,650,816 (GRCm38) E335G probably benign Het
Ptpru T A 4: 131,769,755 (GRCm38) M1416L probably benign Het
Pxn T C 5: 115,544,990 (GRCm38) V117A probably damaging Het
Qsox1 C T 1: 155,812,639 (GRCm38) R54H possibly damaging Het
Rad1 A G 15: 10,488,006 (GRCm38) E42G probably damaging Het
Rpp14 A G 14: 8,090,145 (GRCm38) Y23C probably benign Het
Sdk2 C T 11: 113,834,956 (GRCm38) V1156I probably benign Het
Serpina3j G T 12: 104,319,699 (GRCm38) R371L probably benign Het
Serpinb9d T A 13: 33,197,963 (GRCm38) probably null Het
Sirt5 C T 13: 43,370,791 (GRCm38) S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 (GRCm38) probably benign Het
Slx4 A G 16: 3,986,848 (GRCm38) S701P probably benign Het
Snx29 A G 16: 11,367,681 (GRCm38) T43A probably benign Het
Speg T C 1: 75,423,906 (GRCm38) V2570A probably benign Het
Srrm4 T A 5: 116,453,506 (GRCm38) probably benign Het
Stk32a A G 18: 43,261,316 (GRCm38) Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 (GRCm38) G73E probably benign Het
Thsd7a A T 6: 12,555,435 (GRCm38) I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 (GRCm38) D699E probably damaging Het
Tmem143 A G 7: 45,916,564 (GRCm38) D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 (GRCm38) Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 (GRCm38) T7S probably damaging Het
Tut4 T A 4: 108,550,725 (GRCm38) V1397D probably damaging Het
Ube4b A G 4: 149,347,971 (GRCm38) L832P probably damaging Het
Ugp2 G T 11: 21,329,048 (GRCm38) F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 (GRCm38) D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 (GRCm38) T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 (GRCm38) P14R probably benign Het
Vwc2 C A 11: 11,261,495 (GRCm38) T317K probably damaging Het
Vwf A T 6: 125,628,372 (GRCm38) Q906L probably benign Het
Wdr49 A G 3: 75,429,347 (GRCm38) V351A probably damaging Het
Wdr7 A G 18: 63,728,504 (GRCm38) S196G probably benign Het
Xkr6 C A 14: 63,798,296 (GRCm38) A26E unknown Het
Zfp955b T C 17: 33,305,453 (GRCm38) I47V probably benign Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149,220,602 (GRCm38) missense probably damaging 1.00
IGL01943:Kif1b APN 4 149,214,905 (GRCm38) critical splice donor site probably null
IGL02240:Kif1b APN 4 149,246,414 (GRCm38) missense probably damaging 1.00
IGL02414:Kif1b APN 4 149,199,314 (GRCm38) missense probably damaging 0.96
IGL02490:Kif1b APN 4 149,204,208 (GRCm38) missense probably benign
IGL02501:Kif1b APN 4 149,214,976 (GRCm38) missense probably damaging 1.00
IGL02833:Kif1b APN 4 149,246,364 (GRCm38) missense probably damaging 1.00
IGL02852:Kif1b APN 4 149,291,328 (GRCm38) missense probably damaging 1.00
IGL02900:Kif1b APN 4 149,180,809 (GRCm38) missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149,214,981 (GRCm38) missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149,274,939 (GRCm38) missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149,220,792 (GRCm38) critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149,181,927 (GRCm38) missense probably damaging 1.00
R0044:Kif1b UTSW 4 149,263,601 (GRCm38) splice site probably benign
R0044:Kif1b UTSW 4 149,263,601 (GRCm38) splice site probably benign
R0129:Kif1b UTSW 4 149,261,201 (GRCm38) missense probably benign
R0180:Kif1b UTSW 4 149,213,659 (GRCm38) missense probably damaging 1.00
R0288:Kif1b UTSW 4 149,199,338 (GRCm38) missense probably damaging 1.00
R0360:Kif1b UTSW 4 149,262,729 (GRCm38) missense probably damaging 1.00
R0383:Kif1b UTSW 4 149,202,512 (GRCm38) missense probably damaging 1.00
R0398:Kif1b UTSW 4 149,204,231 (GRCm38) missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149,181,967 (GRCm38) nonsense probably null
R0445:Kif1b UTSW 4 149,188,009 (GRCm38) missense probably benign 0.01
R1466:Kif1b UTSW 4 149,223,252 (GRCm38) missense probably damaging 0.99
R1466:Kif1b UTSW 4 149,223,252 (GRCm38) missense probably damaging 0.99
R1681:Kif1b UTSW 4 149,195,501 (GRCm38) critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149,187,722 (GRCm38) missense probably damaging 0.99
R1840:Kif1b UTSW 4 149,188,132 (GRCm38) missense probably damaging 1.00
R1915:Kif1b UTSW 4 149,267,216 (GRCm38) missense probably damaging 1.00
R2106:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149,222,296 (GRCm38) missense probably benign 0.08
R2126:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149,187,640 (GRCm38) missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149,184,309 (GRCm38) missense probably damaging 0.99
R2255:Kif1b UTSW 4 149,274,997 (GRCm38) missense probably damaging 1.00
R2392:Kif1b UTSW 4 149,220,620 (GRCm38) missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149,237,648 (GRCm38) missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149,220,541 (GRCm38) critical splice donor site probably null
R3038:Kif1b UTSW 4 149,213,333 (GRCm38) missense probably benign 0.02
R3616:Kif1b UTSW 4 149,262,283 (GRCm38) splice site probably benign
R3935:Kif1b UTSW 4 149,237,160 (GRCm38) missense probably benign 0.00
R4347:Kif1b UTSW 4 149,247,234 (GRCm38) missense probably damaging 1.00
R4423:Kif1b UTSW 4 149,214,105 (GRCm38) missense probably damaging 0.99
R4637:Kif1b UTSW 4 149,199,311 (GRCm38) missense probably damaging 0.97
R4745:Kif1b UTSW 4 149,237,882 (GRCm38) nonsense probably null
R4807:Kif1b UTSW 4 149,247,921 (GRCm38) intron probably benign
R5618:Kif1b UTSW 4 149,269,889 (GRCm38) missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149,238,482 (GRCm38) missense probably damaging 0.96
R5683:Kif1b UTSW 4 149,222,261 (GRCm38) missense probably damaging 1.00
R5696:Kif1b UTSW 4 149,273,849 (GRCm38) splice site probably null
R6022:Kif1b UTSW 4 149,198,532 (GRCm38) missense probably benign 0.01
R6048:Kif1b UTSW 4 149,263,629 (GRCm38) missense probably damaging 1.00
R6137:Kif1b UTSW 4 149,238,426 (GRCm38) missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149,237,532 (GRCm38) missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149,258,048 (GRCm38) missense probably damaging 1.00
R6250:Kif1b UTSW 4 149,213,643 (GRCm38) missense probably benign 0.00
R6423:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6424:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6425:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6443:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6460:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6462:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6463:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6469:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6470:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6471:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6472:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6504:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6536:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6537:Kif1b UTSW 4 149,192,596 (GRCm38) missense probably benign 0.16
R6668:Kif1b UTSW 4 149,213,407 (GRCm38) missense probably benign 0.09
R6698:Kif1b UTSW 4 149,274,956 (GRCm38) missense probably damaging 0.99
R7065:Kif1b UTSW 4 149,202,525 (GRCm38) missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149,225,157 (GRCm38) missense probably damaging 1.00
R7342:Kif1b UTSW 4 149,214,090 (GRCm38) missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149,182,355 (GRCm38) missense probably benign 0.01
R7744:Kif1b UTSW 4 149,237,075 (GRCm38) missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149,237,387 (GRCm38) missense probably benign
R7829:Kif1b UTSW 4 149,220,990 (GRCm38) splice site probably null
R7869:Kif1b UTSW 4 149,184,376 (GRCm38) missense probably benign 0.01
R7878:Kif1b UTSW 4 149,214,997 (GRCm38) missense probably damaging 0.98
R7980:Kif1b UTSW 4 149,269,921 (GRCm38) missense probably damaging 1.00
R8047:Kif1b UTSW 4 149,214,922 (GRCm38) missense probably damaging 1.00
R8237:Kif1b UTSW 4 149,191,185 (GRCm38) missense probably benign 0.10
R8243:Kif1b UTSW 4 149,204,267 (GRCm38) missense probably benign
R8252:Kif1b UTSW 4 149,273,805 (GRCm38) missense probably damaging 1.00
R8342:Kif1b UTSW 4 149,222,348 (GRCm38) missense probably damaging 0.96
R8460:Kif1b UTSW 4 149,187,620 (GRCm38) missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149,182,340 (GRCm38) missense probably benign 0.05
R8496:Kif1b UTSW 4 149,192,611 (GRCm38) nonsense probably null
R8687:Kif1b UTSW 4 149,261,163 (GRCm38) nonsense probably null
R8694:Kif1b UTSW 4 149,220,567 (GRCm38) missense probably damaging 0.98
R8842:Kif1b UTSW 4 149,253,739 (GRCm38) missense probably damaging 0.98
R8883:Kif1b UTSW 4 149,276,885 (GRCm38) missense probably benign
R8971:Kif1b UTSW 4 149,247,816 (GRCm38) missense probably damaging 1.00
R8994:Kif1b UTSW 4 149,195,482 (GRCm38) missense
R9002:Kif1b UTSW 4 149,191,255 (GRCm38) missense probably damaging 0.96
R9227:Kif1b UTSW 4 149,237,900 (GRCm38) missense probably damaging 1.00
R9231:Kif1b UTSW 4 149,191,195 (GRCm38) missense possibly damaging 0.94
R9450:Kif1b UTSW 4 149,238,010 (GRCm38) missense probably benign 0.01
R9478:Kif1b UTSW 4 149,261,159 (GRCm38) critical splice donor site probably null
R9571:Kif1b UTSW 4 149,220,641 (GRCm38) missense probably damaging 1.00
R9644:Kif1b UTSW 4 149,291,379 (GRCm38) missense probably damaging 1.00
RF008:Kif1b UTSW 4 149,251,738 (GRCm38) splice site probably null
X0009:Kif1b UTSW 4 149,247,264 (GRCm38) missense probably damaging 1.00
X0062:Kif1b UTSW 4 149,275,005 (GRCm38) missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149,266,298 (GRCm38) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCCTGTGAAGGTAAGGACTGAC -3'
(R):5'- ACGATGTTCCTCTTGTCAGG -3'

Sequencing Primer
(F):5'- AGGTAAGGACTGACCCTTATTATTTC -3'
(R):5'- AAAAACTCGCCACTTCTTGCTG -3'
Posted On 2014-06-30