Incidental Mutation 'R1874:Pole'
ID 211026
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
MMRRC Submission 039896-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110434185-110485319 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110471530 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1425 (V1425M)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
AlphaFold Q9WVF7
Predicted Effect possibly damaging
Transcript: ENSMUST00000007296
AA Change: V1425M

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: V1425M

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182442
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,670,428 (GRCm39) S217G probably benign Het
Adrb3 C A 8: 27,717,591 (GRCm39) R286L probably damaging Het
Akap11 T A 14: 78,749,306 (GRCm39) D1027V probably benign Het
Ank3 A T 10: 69,733,913 (GRCm39) I726F probably damaging Het
Ankmy2 T A 12: 36,215,930 (GRCm39) D43E possibly damaging Het
Ankrd34b A G 13: 92,576,064 (GRCm39) D432G probably damaging Het
Ano3 A C 2: 110,715,217 (GRCm39) S74A probably benign Het
B4galnt4 T A 7: 140,650,439 (GRCm39) S769T probably damaging Het
Bicral T A 17: 47,136,104 (GRCm39) T369S probably benign Het
Blm A G 7: 80,147,166 (GRCm39) L738P probably damaging Het
Bpifb3 A G 2: 153,767,760 (GRCm39) T278A probably benign Het
Bpifb5 A G 2: 154,069,122 (GRCm39) probably benign Het
Brd8 G C 18: 34,743,527 (GRCm39) P266R probably damaging Het
Btaf1 A T 19: 36,957,983 (GRCm39) M587L probably benign Het
Casz1 C G 4: 149,027,668 (GRCm39) T1015S probably damaging Het
Cdh23 A G 10: 60,272,597 (GRCm39) I524T possibly damaging Het
Celsr3 T C 9: 108,713,037 (GRCm39) V1825A probably benign Het
Cenpf A G 1: 189,416,013 (GRCm39) L104P probably damaging Het
Clasp1 G T 1: 118,528,315 (GRCm39) probably null Het
Coprs A G 8: 13,935,112 (GRCm39) W148R probably damaging Het
Cpne1 A G 2: 155,920,302 (GRCm39) S168P probably damaging Het
Cpxm2 T C 7: 131,661,563 (GRCm39) Y408C probably damaging Het
Ctnna3 A G 10: 63,339,886 (GRCm39) E24G possibly damaging Het
Cubn T A 2: 13,327,813 (GRCm39) S2671C probably damaging Het
Cyp4f39 T A 17: 32,702,298 (GRCm39) F265Y probably damaging Het
Dgkq C A 5: 108,808,461 (GRCm39) R34L probably benign Het
Dnajc7 C T 11: 100,490,139 (GRCm39) probably benign Het
Eml6 T G 11: 29,781,136 (GRCm39) D632A probably damaging Het
Fbxl18 G A 5: 142,871,978 (GRCm39) A419V probably damaging Het
Fbxw22 A T 9: 109,214,179 (GRCm39) C212* probably null Het
Ffar2 A G 7: 30,518,839 (GRCm39) probably null Het
Fga A T 3: 82,940,028 (GRCm39) T561S probably damaging Het
Fry A G 5: 150,269,386 (GRCm39) Y159C probably damaging Het
Gal3st1 A G 11: 3,948,231 (GRCm39) Y146C probably damaging Het
Gapvd1 A T 2: 34,596,033 (GRCm39) H788Q probably damaging Het
Gimap7 G A 6: 48,700,449 (GRCm39) V12I possibly damaging Het
Gli2 C A 1: 118,929,779 (GRCm39) A43S possibly damaging Het
Gm15446 T C 5: 110,090,419 (GRCm39) F224L probably damaging Het
Gm21738 C T 14: 19,418,824 (GRCm38) V35I possibly damaging Het
Grhl1 T C 12: 24,636,155 (GRCm39) probably benign Het
Grk6 T C 13: 55,598,086 (GRCm39) Y53H probably damaging Het
Hcar1 C T 5: 124,017,328 (GRCm39) R121K probably damaging Het
Hmcn1 A C 1: 150,596,446 (GRCm39) S1797A probably damaging Het
Hsd17b7 A T 1: 169,783,562 (GRCm39) L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,267,574 (GRCm39) probably null Het
Kif1b C T 4: 149,272,089 (GRCm39) V1571I probably benign Het
Lpl T A 8: 69,349,271 (GRCm39) C266S probably damaging Het
Mag G A 7: 30,608,476 (GRCm39) H213Y probably benign Het
Mansc4 T G 6: 146,976,688 (GRCm39) R309S probably benign Het
Mlh3 A G 12: 85,284,287 (GRCm39) probably null Het
Mndal G A 1: 173,687,933 (GRCm39) probably benign Het
Mrgpra2b T A 7: 47,113,742 (GRCm39) E330V probably damaging Het
Myh3 A G 11: 66,984,005 (GRCm39) I990V probably benign Het
Myoz2 A T 3: 122,819,765 (GRCm39) S65T probably damaging Het
Naa16 T C 14: 79,593,183 (GRCm39) E463G possibly damaging Het
Nadsyn1 A G 7: 143,351,581 (GRCm39) F684S probably damaging Het
Notch1 T C 2: 26,371,591 (GRCm39) E286G possibly damaging Het
Nynrin A T 14: 56,100,950 (GRCm39) I247L probably benign Het
Oprm1 A G 10: 6,739,035 (GRCm39) H54R probably benign Het
Or10g6 T A 9: 39,934,151 (GRCm39) I154N possibly damaging Het
Or2n1d C T 17: 38,646,860 (GRCm39) P271S probably damaging Het
Or51a43 T C 7: 103,717,336 (GRCm39) I301V probably null Het
P4hb C T 11: 120,452,992 (GRCm39) D483N probably benign Het
Pak1 T C 7: 97,520,787 (GRCm39) S149P probably benign Het
Pars2 T C 4: 106,510,913 (GRCm39) F232L possibly damaging Het
Pih1d2 A G 9: 50,532,245 (GRCm39) M88V possibly damaging Het
Pms1 A T 1: 53,246,392 (GRCm39) N382K probably benign Het
Pnliprp2 G T 19: 58,751,821 (GRCm39) V189L probably benign Het
Pot1b T A 17: 55,961,805 (GRCm39) Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 (GRCm39) T301M possibly damaging Het
Psg21 T C 7: 18,384,741 (GRCm39) E335G probably benign Het
Ptpru T A 4: 131,497,066 (GRCm39) M1416L probably benign Het
Pxn T C 5: 115,683,049 (GRCm39) V117A probably damaging Het
Qsox1 C T 1: 155,688,385 (GRCm39) R54H possibly damaging Het
Rad1 A G 15: 10,488,092 (GRCm39) E42G probably damaging Het
Rpp14 A G 14: 8,090,145 (GRCm38) Y23C probably benign Het
Sdk2 C T 11: 113,725,782 (GRCm39) V1156I probably benign Het
Serpina3j G T 12: 104,285,958 (GRCm39) R371L probably benign Het
Serpinb9d T A 13: 33,381,946 (GRCm39) probably null Het
Sirt5 C T 13: 43,524,267 (GRCm39) S13F possibly damaging Het
Slc6a7 T A 18: 61,134,470 (GRCm39) probably benign Het
Slx4 A G 16: 3,804,712 (GRCm39) S701P probably benign Het
Snx29 A G 16: 11,185,545 (GRCm39) T43A probably benign Het
Speg T C 1: 75,400,550 (GRCm39) V2570A probably benign Het
Srrm4 T A 5: 116,591,565 (GRCm39) probably benign Het
Stk32a A G 18: 43,394,381 (GRCm39) Y110C probably damaging Het
Tbc1d31 G A 15: 57,779,506 (GRCm39) G73E probably benign Het
Thsd7a A T 6: 12,555,434 (GRCm39) I150N possibly damaging Het
Tjp1 A T 7: 64,969,001 (GRCm39) D699E probably damaging Het
Tmem143 A G 7: 45,565,988 (GRCm39) D437G possibly damaging Het
Tmem45a2 A G 16: 56,867,447 (GRCm39) Y85H possibly damaging Het
Tmem45b T A 9: 31,340,383 (GRCm39) T7S probably damaging Het
Tut4 T A 4: 108,407,922 (GRCm39) V1397D probably damaging Het
Ube4b A G 4: 149,432,428 (GRCm39) L832P probably damaging Het
Ugp2 G T 11: 21,279,048 (GRCm39) F379L probably damaging Het
Ugt3a1 A T 15: 9,365,437 (GRCm39) D350V probably damaging Het
Vmn2r8 T A 5: 108,950,284 (GRCm39) T188S possibly damaging Het
Vwa7 C G 17: 35,236,088 (GRCm39) P14R probably benign Het
Vwc2 C A 11: 11,211,495 (GRCm39) T317K probably damaging Het
Vwf A T 6: 125,605,335 (GRCm39) Q906L probably benign Het
Wdr49 A G 3: 75,336,654 (GRCm39) V351A probably damaging Het
Wdr7 A G 18: 63,861,575 (GRCm39) S196G probably benign Het
Xkr6 C A 14: 64,035,745 (GRCm39) A26E unknown Het
Zfp955b T C 17: 33,524,427 (GRCm39) I47V probably benign Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110,451,431 (GRCm39) splice site probably benign
IGL00475:Pole APN 5 110,438,962 (GRCm39) nonsense probably null
IGL00837:Pole APN 5 110,449,875 (GRCm39) missense possibly damaging 0.91
IGL00976:Pole APN 5 110,471,438 (GRCm39) missense probably benign 0.00
IGL01081:Pole APN 5 110,485,106 (GRCm39) missense possibly damaging 0.92
IGL01503:Pole APN 5 110,451,750 (GRCm39) missense probably damaging 1.00
IGL01640:Pole APN 5 110,446,132 (GRCm39) missense probably null 0.08
IGL01987:Pole APN 5 110,485,098 (GRCm39) missense probably benign 0.01
IGL02429:Pole APN 5 110,447,666 (GRCm39) missense probably benign
IGL02733:Pole APN 5 110,460,594 (GRCm39) splice site probably benign
IGL03102:Pole APN 5 110,444,939 (GRCm39) missense probably damaging 1.00
IGL03157:Pole APN 5 110,441,619 (GRCm39) missense probably benign
IGL03186:Pole APN 5 110,447,786 (GRCm39) critical splice donor site probably null
IGL03271:Pole APN 5 110,466,185 (GRCm39) missense probably benign
IGL03351:Pole APN 5 110,449,864 (GRCm39) splice site probably benign
IGL03408:Pole APN 5 110,442,426 (GRCm39) missense probably damaging 1.00
IGL03410:Pole APN 5 110,472,425 (GRCm39) missense probably benign
ANU74:Pole UTSW 5 110,437,236 (GRCm39) missense probably benign 0.44
PIT4495001:Pole UTSW 5 110,451,780 (GRCm39) missense probably damaging 1.00
R0053:Pole UTSW 5 110,441,206 (GRCm39) missense probably damaging 1.00
R0053:Pole UTSW 5 110,441,206 (GRCm39) missense probably damaging 1.00
R0124:Pole UTSW 5 110,451,858 (GRCm39) missense probably damaging 0.96
R0145:Pole UTSW 5 110,472,291 (GRCm39) missense probably damaging 0.99
R0523:Pole UTSW 5 110,451,459 (GRCm39) missense probably damaging 0.96
R0590:Pole UTSW 5 110,465,792 (GRCm39) missense probably benign
R0625:Pole UTSW 5 110,473,416 (GRCm39) missense possibly damaging 0.50
R0707:Pole UTSW 5 110,446,854 (GRCm39) missense probably damaging 1.00
R1160:Pole UTSW 5 110,443,119 (GRCm39) missense possibly damaging 0.85
R1320:Pole UTSW 5 110,456,995 (GRCm39) frame shift probably null
R1384:Pole UTSW 5 110,471,530 (GRCm39) missense possibly damaging 0.81
R1626:Pole UTSW 5 110,441,235 (GRCm39) missense probably benign 0.25
R1643:Pole UTSW 5 110,465,711 (GRCm39) missense probably damaging 1.00
R1655:Pole UTSW 5 110,483,788 (GRCm39) missense probably damaging 1.00
R1668:Pole UTSW 5 110,445,235 (GRCm39) missense probably damaging 1.00
R1783:Pole UTSW 5 110,445,296 (GRCm39) missense probably damaging 1.00
R1843:Pole UTSW 5 110,478,701 (GRCm39) critical splice donor site probably null
R1853:Pole UTSW 5 110,454,719 (GRCm39) missense possibly damaging 0.95
R1867:Pole UTSW 5 110,482,063 (GRCm39) missense probably benign 0.08
R1891:Pole UTSW 5 110,480,408 (GRCm39) missense probably damaging 1.00
R1928:Pole UTSW 5 110,475,644 (GRCm39) missense probably benign
R2073:Pole UTSW 5 110,473,417 (GRCm39) missense probably damaging 0.99
R2341:Pole UTSW 5 110,478,829 (GRCm39) missense possibly damaging 0.67
R2448:Pole UTSW 5 110,444,958 (GRCm39) missense probably damaging 1.00
R2504:Pole UTSW 5 110,438,368 (GRCm39) splice site probably null
R3053:Pole UTSW 5 110,437,661 (GRCm39) missense probably damaging 1.00
R3892:Pole UTSW 5 110,484,305 (GRCm39) missense probably damaging 1.00
R3964:Pole UTSW 5 110,460,648 (GRCm39) missense probably damaging 1.00
R3965:Pole UTSW 5 110,460,648 (GRCm39) missense probably damaging 1.00
R4374:Pole UTSW 5 110,485,071 (GRCm39) missense possibly damaging 0.89
R4376:Pole UTSW 5 110,485,071 (GRCm39) missense possibly damaging 0.89
R4377:Pole UTSW 5 110,485,071 (GRCm39) missense possibly damaging 0.89
R4520:Pole UTSW 5 110,445,790 (GRCm39) missense probably damaging 1.00
R4670:Pole UTSW 5 110,454,253 (GRCm39) missense probably benign 0.01
R4778:Pole UTSW 5 110,478,698 (GRCm39) missense probably benign 0.00
R4887:Pole UTSW 5 110,472,619 (GRCm39) missense probably damaging 0.99
R4898:Pole UTSW 5 110,438,090 (GRCm39) critical splice acceptor site probably null
R5184:Pole UTSW 5 110,442,800 (GRCm39) missense possibly damaging 0.91
R5359:Pole UTSW 5 110,480,354 (GRCm39) missense probably benign 0.03
R5483:Pole UTSW 5 110,442,434 (GRCm39) missense probably damaging 1.00
R5529:Pole UTSW 5 110,480,332 (GRCm39) missense probably benign 0.20
R5576:Pole UTSW 5 110,459,931 (GRCm39) nonsense probably null
R5817:Pole UTSW 5 110,460,838 (GRCm39) missense probably damaging 1.00
R5877:Pole UTSW 5 110,480,329 (GRCm39) missense probably benign
R5956:Pole UTSW 5 110,485,153 (GRCm39) unclassified probably benign
R5990:Pole UTSW 5 110,450,010 (GRCm39) missense probably damaging 1.00
R6019:Pole UTSW 5 110,472,381 (GRCm39) missense probably benign 0.01
R6019:Pole UTSW 5 110,472,380 (GRCm39) missense probably benign 0.01
R6093:Pole UTSW 5 110,459,956 (GRCm39) missense probably benign 0.01
R6376:Pole UTSW 5 110,484,240 (GRCm39) missense probably damaging 0.99
R6494:Pole UTSW 5 110,472,588 (GRCm39) missense possibly damaging 0.86
R6535:Pole UTSW 5 110,472,673 (GRCm39) missense probably damaging 1.00
R6723:Pole UTSW 5 110,471,482 (GRCm39) missense probably benign 0.11
R6757:Pole UTSW 5 110,451,476 (GRCm39) missense probably damaging 1.00
R6930:Pole UTSW 5 110,441,156 (GRCm39) missense probably benign 0.01
R6988:Pole UTSW 5 110,477,449 (GRCm39) missense probably damaging 0.97
R6992:Pole UTSW 5 110,480,365 (GRCm39) missense probably damaging 0.99
R7067:Pole UTSW 5 110,482,084 (GRCm39) missense probably damaging 1.00
R7097:Pole UTSW 5 110,472,968 (GRCm39) splice site probably null
R7122:Pole UTSW 5 110,472,968 (GRCm39) splice site probably null
R7202:Pole UTSW 5 110,444,973 (GRCm39) missense possibly damaging 0.94
R7340:Pole UTSW 5 110,482,330 (GRCm39) missense probably benign 0.06
R7345:Pole UTSW 5 110,451,769 (GRCm39) missense possibly damaging 0.82
R7509:Pole UTSW 5 110,478,571 (GRCm39) start gained probably benign
R7557:Pole UTSW 5 110,460,860 (GRCm39) missense probably damaging 1.00
R7740:Pole UTSW 5 110,478,907 (GRCm39) missense probably benign 0.00
R7792:Pole UTSW 5 110,445,332 (GRCm39) splice site probably null
R7832:Pole UTSW 5 110,465,663 (GRCm39) missense probably benign 0.00
R7849:Pole UTSW 5 110,480,414 (GRCm39) missense probably benign 0.04
R7852:Pole UTSW 5 110,454,695 (GRCm39) missense probably damaging 1.00
R7960:Pole UTSW 5 110,437,727 (GRCm39) missense possibly damaging 0.81
R8001:Pole UTSW 5 110,460,600 (GRCm39) missense probably damaging 1.00
R8266:Pole UTSW 5 110,442,786 (GRCm39) missense probably damaging 1.00
R8510:Pole UTSW 5 110,482,312 (GRCm39) missense probably damaging 0.99
R8793:Pole UTSW 5 110,445,614 (GRCm39) missense probably damaging 1.00
R8835:Pole UTSW 5 110,454,775 (GRCm39) missense probably damaging 1.00
R8863:Pole UTSW 5 110,437,233 (GRCm39) missense possibly damaging 0.94
R8929:Pole UTSW 5 110,445,654 (GRCm39) missense probably damaging 0.98
R8968:Pole UTSW 5 110,459,949 (GRCm39) missense possibly damaging 0.78
R8992:Pole UTSW 5 110,471,488 (GRCm39) missense possibly damaging 0.88
R9018:Pole UTSW 5 110,437,675 (GRCm39) missense probably benign 0.37
R9177:Pole UTSW 5 110,480,288 (GRCm39) missense probably benign 0.04
R9250:Pole UTSW 5 110,447,687 (GRCm39) missense possibly damaging 0.88
R9262:Pole UTSW 5 110,473,423 (GRCm39) missense probably damaging 1.00
R9262:Pole UTSW 5 110,473,422 (GRCm39) missense probably damaging 0.99
R9367:Pole UTSW 5 110,444,955 (GRCm39) missense probably damaging 0.99
R9383:Pole UTSW 5 110,438,892 (GRCm39) missense possibly damaging 0.61
R9626:Pole UTSW 5 110,459,959 (GRCm39) missense possibly damaging 0.68
R9676:Pole UTSW 5 110,443,431 (GRCm39) missense probably benign 0.00
R9720:Pole UTSW 5 110,484,909 (GRCm39) missense probably benign 0.01
R9787:Pole UTSW 5 110,465,866 (GRCm39) critical splice donor site probably null
R9794:Pole UTSW 5 110,466,201 (GRCm39) missense probably benign 0.01
X0064:Pole UTSW 5 110,465,770 (GRCm39) nonsense probably null
Y5377:Pole UTSW 5 110,442,757 (GRCm39) critical splice acceptor site probably null
Y5380:Pole UTSW 5 110,442,757 (GRCm39) critical splice acceptor site probably null
Z1088:Pole UTSW 5 110,475,731 (GRCm39) missense possibly damaging 0.66
Z1177:Pole UTSW 5 110,444,875 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGAGTTGGTTAGTGATCCAC -3'
(R):5'- TATCTGTGGCCACATACCCC -3'

Sequencing Primer
(F):5'- GTTAGTGATCCACTCCGTAGGC -3'
(R):5'- ATAGTCTGTCTTCACCTACAAGAC -3'
Posted On 2014-06-30