Incidental Mutation 'R1874:Pole'
ID 211026
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110286306-110337474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110323664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1425 (V1425M)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
AlphaFold Q9WVF7
Predicted Effect possibly damaging
Transcript: ENSMUST00000007296
AA Change: V1425M

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: V1425M

POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182442
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7960:Pole UTSW 5 110289861 missense possibly damaging 0.81
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8835:Pole UTSW 5 110306909 missense probably damaging 1.00
R8863:Pole UTSW 5 110289367 missense possibly damaging 0.94
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
R8968:Pole UTSW 5 110312083 missense possibly damaging 0.78
R8992:Pole UTSW 5 110323622 missense possibly damaging 0.88
R9018:Pole UTSW 5 110289809 missense probably benign 0.37
R9177:Pole UTSW 5 110332422 missense probably benign 0.04
R9250:Pole UTSW 5 110299821 missense possibly damaging 0.88
R9262:Pole UTSW 5 110325556 missense probably damaging 0.99
R9262:Pole UTSW 5 110325557 missense probably damaging 1.00
R9367:Pole UTSW 5 110297089 missense probably damaging 0.99
R9383:Pole UTSW 5 110291026 missense possibly damaging 0.61
R9626:Pole UTSW 5 110312093 missense possibly damaging 0.68
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-30