Incidental Mutation 'R1874:Pxn'
ID 211027
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Name paxillin
Synonyms Pax
MMRRC Submission 039896-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1874 (G1)
Quality Score 136
Status Not validated
Chromosome 5
Chromosomal Location 115644735-115694046 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115683049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 117 (V117A)
Ref Sequence ENSEMBL: ENSMUSP00000148843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000212819] [ENSMUST00000157050] [ENSMUST00000202564] [ENSMUST00000137716]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000067268
AA Change: V117A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528
AA Change: V117A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086523
AA Change: V117A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528
AA Change: V117A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134198
Predicted Effect probably damaging
Transcript: ENSMUST00000212819
AA Change: V117A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152156
Predicted Effect probably benign
Transcript: ENSMUST00000157050
SMART Domains Protein: ENSMUSP00000143926
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 106 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202564
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137716
SMART Domains Protein: ENSMUSP00000144513
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 1.9e-60 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,670,428 (GRCm39) S217G probably benign Het
Adrb3 C A 8: 27,717,591 (GRCm39) R286L probably damaging Het
Akap11 T A 14: 78,749,306 (GRCm39) D1027V probably benign Het
Ank3 A T 10: 69,733,913 (GRCm39) I726F probably damaging Het
Ankmy2 T A 12: 36,215,930 (GRCm39) D43E possibly damaging Het
Ankrd34b A G 13: 92,576,064 (GRCm39) D432G probably damaging Het
Ano3 A C 2: 110,715,217 (GRCm39) S74A probably benign Het
B4galnt4 T A 7: 140,650,439 (GRCm39) S769T probably damaging Het
Bicral T A 17: 47,136,104 (GRCm39) T369S probably benign Het
Blm A G 7: 80,147,166 (GRCm39) L738P probably damaging Het
Bpifb3 A G 2: 153,767,760 (GRCm39) T278A probably benign Het
Bpifb5 A G 2: 154,069,122 (GRCm39) probably benign Het
Brd8 G C 18: 34,743,527 (GRCm39) P266R probably damaging Het
Btaf1 A T 19: 36,957,983 (GRCm39) M587L probably benign Het
Casz1 C G 4: 149,027,668 (GRCm39) T1015S probably damaging Het
Cdh23 A G 10: 60,272,597 (GRCm39) I524T possibly damaging Het
Celsr3 T C 9: 108,713,037 (GRCm39) V1825A probably benign Het
Cenpf A G 1: 189,416,013 (GRCm39) L104P probably damaging Het
Clasp1 G T 1: 118,528,315 (GRCm39) probably null Het
Coprs A G 8: 13,935,112 (GRCm39) W148R probably damaging Het
Cpne1 A G 2: 155,920,302 (GRCm39) S168P probably damaging Het
Cpxm2 T C 7: 131,661,563 (GRCm39) Y408C probably damaging Het
Ctnna3 A G 10: 63,339,886 (GRCm39) E24G possibly damaging Het
Cubn T A 2: 13,327,813 (GRCm39) S2671C probably damaging Het
Cyp4f39 T A 17: 32,702,298 (GRCm39) F265Y probably damaging Het
Dgkq C A 5: 108,808,461 (GRCm39) R34L probably benign Het
Dnajc7 C T 11: 100,490,139 (GRCm39) probably benign Het
Eml6 T G 11: 29,781,136 (GRCm39) D632A probably damaging Het
Fbxl18 G A 5: 142,871,978 (GRCm39) A419V probably damaging Het
Fbxw22 A T 9: 109,214,179 (GRCm39) C212* probably null Het
Ffar2 A G 7: 30,518,839 (GRCm39) probably null Het
Fga A T 3: 82,940,028 (GRCm39) T561S probably damaging Het
Fry A G 5: 150,269,386 (GRCm39) Y159C probably damaging Het
Gal3st1 A G 11: 3,948,231 (GRCm39) Y146C probably damaging Het
Gapvd1 A T 2: 34,596,033 (GRCm39) H788Q probably damaging Het
Gimap7 G A 6: 48,700,449 (GRCm39) V12I possibly damaging Het
Gli2 C A 1: 118,929,779 (GRCm39) A43S possibly damaging Het
Gm15446 T C 5: 110,090,419 (GRCm39) F224L probably damaging Het
Gm21738 C T 14: 19,418,824 (GRCm38) V35I possibly damaging Het
Grhl1 T C 12: 24,636,155 (GRCm39) probably benign Het
Grk6 T C 13: 55,598,086 (GRCm39) Y53H probably damaging Het
Hcar1 C T 5: 124,017,328 (GRCm39) R121K probably damaging Het
Hmcn1 A C 1: 150,596,446 (GRCm39) S1797A probably damaging Het
Hsd17b7 A T 1: 169,783,562 (GRCm39) L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,267,574 (GRCm39) probably null Het
Kif1b C T 4: 149,272,089 (GRCm39) V1571I probably benign Het
Lpl T A 8: 69,349,271 (GRCm39) C266S probably damaging Het
Mag G A 7: 30,608,476 (GRCm39) H213Y probably benign Het
Mansc4 T G 6: 146,976,688 (GRCm39) R309S probably benign Het
Mlh3 A G 12: 85,284,287 (GRCm39) probably null Het
Mndal G A 1: 173,687,933 (GRCm39) probably benign Het
Mrgpra2b T A 7: 47,113,742 (GRCm39) E330V probably damaging Het
Myh3 A G 11: 66,984,005 (GRCm39) I990V probably benign Het
Myoz2 A T 3: 122,819,765 (GRCm39) S65T probably damaging Het
Naa16 T C 14: 79,593,183 (GRCm39) E463G possibly damaging Het
Nadsyn1 A G 7: 143,351,581 (GRCm39) F684S probably damaging Het
Notch1 T C 2: 26,371,591 (GRCm39) E286G possibly damaging Het
Nynrin A T 14: 56,100,950 (GRCm39) I247L probably benign Het
Oprm1 A G 10: 6,739,035 (GRCm39) H54R probably benign Het
Or10g6 T A 9: 39,934,151 (GRCm39) I154N possibly damaging Het
Or2n1d C T 17: 38,646,860 (GRCm39) P271S probably damaging Het
Or51a43 T C 7: 103,717,336 (GRCm39) I301V probably null Het
P4hb C T 11: 120,452,992 (GRCm39) D483N probably benign Het
Pak1 T C 7: 97,520,787 (GRCm39) S149P probably benign Het
Pars2 T C 4: 106,510,913 (GRCm39) F232L possibly damaging Het
Pih1d2 A G 9: 50,532,245 (GRCm39) M88V possibly damaging Het
Pms1 A T 1: 53,246,392 (GRCm39) N382K probably benign Het
Pnliprp2 G T 19: 58,751,821 (GRCm39) V189L probably benign Het
Pole G A 5: 110,471,530 (GRCm39) V1425M possibly damaging Het
Pot1b T A 17: 55,961,805 (GRCm39) Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 (GRCm39) T301M possibly damaging Het
Psg21 T C 7: 18,384,741 (GRCm39) E335G probably benign Het
Ptpru T A 4: 131,497,066 (GRCm39) M1416L probably benign Het
Qsox1 C T 1: 155,688,385 (GRCm39) R54H possibly damaging Het
Rad1 A G 15: 10,488,092 (GRCm39) E42G probably damaging Het
Rpp14 A G 14: 8,090,145 (GRCm38) Y23C probably benign Het
Sdk2 C T 11: 113,725,782 (GRCm39) V1156I probably benign Het
Serpina3j G T 12: 104,285,958 (GRCm39) R371L probably benign Het
Serpinb9d T A 13: 33,381,946 (GRCm39) probably null Het
Sirt5 C T 13: 43,524,267 (GRCm39) S13F possibly damaging Het
Slc6a7 T A 18: 61,134,470 (GRCm39) probably benign Het
Slx4 A G 16: 3,804,712 (GRCm39) S701P probably benign Het
Snx29 A G 16: 11,185,545 (GRCm39) T43A probably benign Het
Speg T C 1: 75,400,550 (GRCm39) V2570A probably benign Het
Srrm4 T A 5: 116,591,565 (GRCm39) probably benign Het
Stk32a A G 18: 43,394,381 (GRCm39) Y110C probably damaging Het
Tbc1d31 G A 15: 57,779,506 (GRCm39) G73E probably benign Het
Thsd7a A T 6: 12,555,434 (GRCm39) I150N possibly damaging Het
Tjp1 A T 7: 64,969,001 (GRCm39) D699E probably damaging Het
Tmem143 A G 7: 45,565,988 (GRCm39) D437G possibly damaging Het
Tmem45a2 A G 16: 56,867,447 (GRCm39) Y85H possibly damaging Het
Tmem45b T A 9: 31,340,383 (GRCm39) T7S probably damaging Het
Tut4 T A 4: 108,407,922 (GRCm39) V1397D probably damaging Het
Ube4b A G 4: 149,432,428 (GRCm39) L832P probably damaging Het
Ugp2 G T 11: 21,279,048 (GRCm39) F379L probably damaging Het
Ugt3a1 A T 15: 9,365,437 (GRCm39) D350V probably damaging Het
Vmn2r8 T A 5: 108,950,284 (GRCm39) T188S possibly damaging Het
Vwa7 C G 17: 35,236,088 (GRCm39) P14R probably benign Het
Vwc2 C A 11: 11,211,495 (GRCm39) T317K probably damaging Het
Vwf A T 6: 125,605,335 (GRCm39) Q906L probably benign Het
Wdr49 A G 3: 75,336,654 (GRCm39) V351A probably damaging Het
Wdr7 A G 18: 63,861,575 (GRCm39) S196G probably benign Het
Xkr6 C A 14: 64,035,745 (GRCm39) A26E unknown Het
Zfp955b T C 17: 33,524,427 (GRCm39) I47V probably benign Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115,682,985 (GRCm39) missense probably benign 0.00
IGL02432:Pxn APN 5 115,683,805 (GRCm39) missense probably damaging 1.00
IGL02454:Pxn APN 5 115,690,325 (GRCm39) missense probably damaging 1.00
R0316:Pxn UTSW 5 115,692,027 (GRCm39) missense probably damaging 1.00
R0778:Pxn UTSW 5 115,690,236 (GRCm39) missense probably damaging 1.00
R1680:Pxn UTSW 5 115,690,206 (GRCm39) missense probably damaging 1.00
R2069:Pxn UTSW 5 115,683,726 (GRCm39) missense probably benign 0.26
R2145:Pxn UTSW 5 115,690,815 (GRCm39) unclassified probably benign
R4124:Pxn UTSW 5 115,684,966 (GRCm39) missense probably damaging 1.00
R4126:Pxn UTSW 5 115,684,966 (GRCm39) missense probably damaging 1.00
R4127:Pxn UTSW 5 115,684,966 (GRCm39) missense probably damaging 1.00
R4551:Pxn UTSW 5 115,690,779 (GRCm39) unclassified probably benign
R4717:Pxn UTSW 5 115,690,001 (GRCm39) missense probably damaging 0.99
R5217:Pxn UTSW 5 115,682,974 (GRCm39) missense probably benign 0.13
R5332:Pxn UTSW 5 115,682,428 (GRCm39) missense probably damaging 1.00
R5635:Pxn UTSW 5 115,689,551 (GRCm39) missense probably benign
R5681:Pxn UTSW 5 115,682,593 (GRCm39) missense possibly damaging 0.94
R6629:Pxn UTSW 5 115,692,121 (GRCm39) missense probably damaging 1.00
R6702:Pxn UTSW 5 115,689,955 (GRCm39) missense probably benign 0.11
R7516:Pxn UTSW 5 115,644,922 (GRCm39) missense unknown
R7671:Pxn UTSW 5 115,686,606 (GRCm39) missense not run
R7749:Pxn UTSW 5 115,686,575 (GRCm39) missense probably benign 0.00
R7866:Pxn UTSW 5 115,686,665 (GRCm39) missense possibly damaging 0.85
R8196:Pxn UTSW 5 115,683,768 (GRCm39) missense probably damaging 0.99
R8244:Pxn UTSW 5 115,690,302 (GRCm39) missense probably damaging 1.00
R9096:Pxn UTSW 5 115,686,680 (GRCm39) missense probably benign 0.23
X0018:Pxn UTSW 5 115,683,791 (GRCm39) missense probably damaging 1.00
X0025:Pxn UTSW 5 115,684,954 (GRCm39) missense probably damaging 0.97
X0065:Pxn UTSW 5 115,689,546 (GRCm39) critical splice acceptor site probably null
Z1177:Pxn UTSW 5 115,691,952 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAAATTCCCTGTGAGACAG -3'
(R):5'- AGTTCCTCAACTACACAGATGC -3'

Sequencing Primer
(F):5'- CTGTGAGACAGGCTGCGAG -3'
(R):5'- TACACAGATGCTGTGGGAGCCCAGC -3'
Posted On 2014-06-30