Incidental Mutation 'R1874:Tjp1'
ID 211044
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Name tight junction protein 1
Synonyms ZO1, ZO-1
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 65296165-65527781 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65319253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 699 (D699E)
Ref Sequence ENSEMBL: ENSMUSP00000146149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206612]
AlphaFold P39447
Predicted Effect probably damaging
Transcript: ENSMUST00000032729
AA Change: D699E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: D699E

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102592
AA Change: D699E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: D699E

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206612
AA Change: D699E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0390:Tjp1 UTSW 7 65314990 missense probably damaging 1.00
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1771:Tjp1 UTSW 7 65313005 missense probably benign 0.45
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2086:Tjp1 UTSW 7 65312921 missense probably damaging 1.00
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4574:Tjp1 UTSW 7 65322605 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7235:Tjp1 UTSW 7 65318573 missense probably benign 0.16
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
R8035:Tjp1 UTSW 7 65342702 missense probably benign 0.34
R8195:Tjp1 UTSW 7 65343722 missense probably damaging 1.00
R8276:Tjp1 UTSW 7 65343796 intron probably benign
R8817:Tjp1 UTSW 7 65303062 missense probably benign 0.41
R8869:Tjp1 UTSW 7 65336638 missense probably damaging 1.00
R9043:Tjp1 UTSW 7 65312931 missense probably benign 0.03
R9079:Tjp1 UTSW 7 65301218 missense possibly damaging 0.77
R9081:Tjp1 UTSW 7 65314262 missense possibly damaging 0.71
R9095:Tjp1 UTSW 7 65302997 missense possibly damaging 0.82
R9145:Tjp1 UTSW 7 65302816 missense probably benign 0.00
R9215:Tjp1 UTSW 7 65312847 missense probably benign
R9581:Tjp1 UTSW 7 65299724 missense probably damaging 1.00
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Z1177:Tjp1 UTSW 7 65343732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCCTGCTGATGGTGATC -3'
(R):5'- AGTAGATGGCTACCTCCTTTAGTG -3'

Sequencing Primer
(F):5'- CCTGCTGATGGTGATCACAGATATC -3'
(R):5'- CTCTAGTGGGCAGAATCCATACTG -3'
Posted On 2014-06-30