Incidental Mutation 'R1874:B4galnt4'
ID211050
Institutional Source Beutler Lab
Gene Symbol B4galnt4
Ensembl Gene ENSMUSG00000055629
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 4
SynonymsLOC381951
MMRRC Submission 039896-MU
Accession Numbers

Genbank: NM_177897; MGI: 2652891

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1874 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141061104-141072400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141070526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 769 (S769T)
Ref Sequence ENSEMBL: ENSMUSP00000039758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048002]
Predicted Effect probably damaging
Transcript: ENSMUST00000048002
AA Change: S769T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039758
Gene: ENSMUSG00000055629
AA Change: S769T

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
PA14 129 276 6.07e-7 SMART
low complexity region 412 421 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
low complexity region 461 481 N/A INTRINSIC
low complexity region 634 660 N/A INTRINSIC
Pfam:CHGN 691 1024 8.9e-31 PFAM
Pfam:Glyco_transf_7C 939 1017 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209546
Predicted Effect probably benign
Transcript: ENSMUST00000210517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211455
Meta Mutation Damage Score 0.4178 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in B4galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:B4galnt4 APN 7 141070515 missense probably benign 0.15
IGL02055:B4galnt4 APN 7 141070818 missense probably damaging 1.00
IGL02248:B4galnt4 APN 7 141067808 unclassified probably benign
IGL02955:B4galnt4 APN 7 141064678 missense probably null 0.08
IGL03334:B4galnt4 APN 7 141067441 splice site probably null
H8786:B4galnt4 UTSW 7 141071322 missense probably damaging 0.99
R0520:B4galnt4 UTSW 7 141067373 nonsense probably null
R0735:B4galnt4 UTSW 7 141064323 missense probably benign 0.24
R1355:B4galnt4 UTSW 7 141065395 missense probably damaging 1.00
R1864:B4galnt4 UTSW 7 141070533 missense probably damaging 1.00
R1928:B4galnt4 UTSW 7 141068148 nonsense probably null
R1969:B4galnt4 UTSW 7 141064848 missense probably benign 0.01
R3429:B4galnt4 UTSW 7 141070839 missense probably damaging 1.00
R4239:B4galnt4 UTSW 7 141061326 missense probably damaging 1.00
R4382:B4galnt4 UTSW 7 141070536 missense probably damaging 0.99
R4517:B4galnt4 UTSW 7 141067722 missense probably damaging 1.00
R4748:B4galnt4 UTSW 7 141071720 missense probably damaging 1.00
R4827:B4galnt4 UTSW 7 141068479 missense probably benign 0.00
R4831:B4galnt4 UTSW 7 141067721 missense probably damaging 0.99
R4831:B4galnt4 UTSW 7 141064557 critical splice donor site probably null
R4898:B4galnt4 UTSW 7 141068260 missense probably benign 0.11
R5028:B4galnt4 UTSW 7 141068062 missense probably benign 0.40
R5249:B4galnt4 UTSW 7 141065070 missense probably damaging 1.00
R5267:B4galnt4 UTSW 7 141070611 missense probably damaging 0.99
R5728:B4galnt4 UTSW 7 141070575 missense probably benign 0.00
R5924:B4galnt4 UTSW 7 141070829 missense probably damaging 1.00
R6063:B4galnt4 UTSW 7 141064730 missense probably benign 0.08
R6311:B4galnt4 UTSW 7 141068659 missense probably damaging 1.00
R6376:B4galnt4 UTSW 7 141067422 missense possibly damaging 0.87
R6689:B4galnt4 UTSW 7 141067984 missense probably benign 0.25
R6954:B4galnt4 UTSW 7 141067232 missense probably benign 0.01
R6974:B4galnt4 UTSW 7 141067536 missense possibly damaging 0.95
R7041:B4galnt4 UTSW 7 141070680 missense probably damaging 1.00
R7092:B4galnt4 UTSW 7 141068636 missense probably damaging 1.00
R7359:B4galnt4 UTSW 7 141071284 missense probably damaging 1.00
R7367:B4galnt4 UTSW 7 141064475 missense probably damaging 1.00
R7409:B4galnt4 UTSW 7 141067003 splice site probably null
R7519:B4galnt4 UTSW 7 141064344 missense probably damaging 1.00
R7664:B4galnt4 UTSW 7 141067713 missense probably damaging 1.00
R7679:B4galnt4 UTSW 7 141067765 missense probably benign 0.28
R7782:B4galnt4 UTSW 7 141065075 missense probably damaging 1.00
RF007:B4galnt4 UTSW 7 141070696 critical splice donor site probably null
YA93:B4galnt4 UTSW 7 141067411 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGAACGGGTTGCAGGTATTG -3'
(R):5'- GCACATACCTGGTACAATGAAATG -3'

Sequencing Primer
(F):5'- AGTACAGTCGCGTGGTTCTC -3'
(R):5'- TGAACCATGACATCCTGACG -3'
Posted On2014-06-30