Incidental Mutation 'R1874:Nadsyn1'
ID 211051
Institutional Source Beutler Lab
Gene Symbol Nadsyn1
Ensembl Gene ENSMUSG00000031090
Gene Name NAD synthetase 1
Synonyms 9130012B15Rik
MMRRC Submission 039896-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1874 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 143349321-143376586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143351581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 684 (F684S)
Ref Sequence ENSEMBL: ENSMUSP00000033415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033415] [ENSMUST00000132520] [ENSMUST00000156638]
AlphaFold Q711T7
Predicted Effect probably damaging
Transcript: ENSMUST00000033415
AA Change: F684S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033415
Gene: ENSMUSG00000031090
AA Change: F684S

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 283 3.2e-52 PFAM
Pfam:NAD_synthase 337 649 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132520
SMART Domains Protein: ENSMUSP00000114380
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 201 6.3e-39 PFAM
Pfam:NAD_synthase 336 561 8.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155088
Predicted Effect probably benign
Transcript: ENSMUST00000156638
SMART Domains Protein: ENSMUSP00000114889
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,670,428 (GRCm39) S217G probably benign Het
Adrb3 C A 8: 27,717,591 (GRCm39) R286L probably damaging Het
Akap11 T A 14: 78,749,306 (GRCm39) D1027V probably benign Het
Ank3 A T 10: 69,733,913 (GRCm39) I726F probably damaging Het
Ankmy2 T A 12: 36,215,930 (GRCm39) D43E possibly damaging Het
Ankrd34b A G 13: 92,576,064 (GRCm39) D432G probably damaging Het
Ano3 A C 2: 110,715,217 (GRCm39) S74A probably benign Het
B4galnt4 T A 7: 140,650,439 (GRCm39) S769T probably damaging Het
Bicral T A 17: 47,136,104 (GRCm39) T369S probably benign Het
Blm A G 7: 80,147,166 (GRCm39) L738P probably damaging Het
Bpifb3 A G 2: 153,767,760 (GRCm39) T278A probably benign Het
Bpifb5 A G 2: 154,069,122 (GRCm39) probably benign Het
Brd8 G C 18: 34,743,527 (GRCm39) P266R probably damaging Het
Btaf1 A T 19: 36,957,983 (GRCm39) M587L probably benign Het
Casz1 C G 4: 149,027,668 (GRCm39) T1015S probably damaging Het
Cdh23 A G 10: 60,272,597 (GRCm39) I524T possibly damaging Het
Celsr3 T C 9: 108,713,037 (GRCm39) V1825A probably benign Het
Cenpf A G 1: 189,416,013 (GRCm39) L104P probably damaging Het
Clasp1 G T 1: 118,528,315 (GRCm39) probably null Het
Coprs A G 8: 13,935,112 (GRCm39) W148R probably damaging Het
Cpne1 A G 2: 155,920,302 (GRCm39) S168P probably damaging Het
Cpxm2 T C 7: 131,661,563 (GRCm39) Y408C probably damaging Het
Ctnna3 A G 10: 63,339,886 (GRCm39) E24G possibly damaging Het
Cubn T A 2: 13,327,813 (GRCm39) S2671C probably damaging Het
Cyp4f39 T A 17: 32,702,298 (GRCm39) F265Y probably damaging Het
Dgkq C A 5: 108,808,461 (GRCm39) R34L probably benign Het
Dnajc7 C T 11: 100,490,139 (GRCm39) probably benign Het
Eml6 T G 11: 29,781,136 (GRCm39) D632A probably damaging Het
Fbxl18 G A 5: 142,871,978 (GRCm39) A419V probably damaging Het
Fbxw22 A T 9: 109,214,179 (GRCm39) C212* probably null Het
Ffar2 A G 7: 30,518,839 (GRCm39) probably null Het
Fga A T 3: 82,940,028 (GRCm39) T561S probably damaging Het
Fry A G 5: 150,269,386 (GRCm39) Y159C probably damaging Het
Gal3st1 A G 11: 3,948,231 (GRCm39) Y146C probably damaging Het
Gapvd1 A T 2: 34,596,033 (GRCm39) H788Q probably damaging Het
Gimap7 G A 6: 48,700,449 (GRCm39) V12I possibly damaging Het
Gli2 C A 1: 118,929,779 (GRCm39) A43S possibly damaging Het
Gm15446 T C 5: 110,090,419 (GRCm39) F224L probably damaging Het
Gm21738 C T 14: 19,418,824 (GRCm38) V35I possibly damaging Het
Grhl1 T C 12: 24,636,155 (GRCm39) probably benign Het
Grk6 T C 13: 55,598,086 (GRCm39) Y53H probably damaging Het
Hcar1 C T 5: 124,017,328 (GRCm39) R121K probably damaging Het
Hmcn1 A C 1: 150,596,446 (GRCm39) S1797A probably damaging Het
Hsd17b7 A T 1: 169,783,562 (GRCm39) L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,267,574 (GRCm39) probably null Het
Kif1b C T 4: 149,272,089 (GRCm39) V1571I probably benign Het
Lpl T A 8: 69,349,271 (GRCm39) C266S probably damaging Het
Mag G A 7: 30,608,476 (GRCm39) H213Y probably benign Het
Mansc4 T G 6: 146,976,688 (GRCm39) R309S probably benign Het
Mlh3 A G 12: 85,284,287 (GRCm39) probably null Het
Mndal G A 1: 173,687,933 (GRCm39) probably benign Het
Mrgpra2b T A 7: 47,113,742 (GRCm39) E330V probably damaging Het
Myh3 A G 11: 66,984,005 (GRCm39) I990V probably benign Het
Myoz2 A T 3: 122,819,765 (GRCm39) S65T probably damaging Het
Naa16 T C 14: 79,593,183 (GRCm39) E463G possibly damaging Het
Notch1 T C 2: 26,371,591 (GRCm39) E286G possibly damaging Het
Nynrin A T 14: 56,100,950 (GRCm39) I247L probably benign Het
Oprm1 A G 10: 6,739,035 (GRCm39) H54R probably benign Het
Or10g6 T A 9: 39,934,151 (GRCm39) I154N possibly damaging Het
Or2n1d C T 17: 38,646,860 (GRCm39) P271S probably damaging Het
Or51a43 T C 7: 103,717,336 (GRCm39) I301V probably null Het
P4hb C T 11: 120,452,992 (GRCm39) D483N probably benign Het
Pak1 T C 7: 97,520,787 (GRCm39) S149P probably benign Het
Pars2 T C 4: 106,510,913 (GRCm39) F232L possibly damaging Het
Pih1d2 A G 9: 50,532,245 (GRCm39) M88V possibly damaging Het
Pms1 A T 1: 53,246,392 (GRCm39) N382K probably benign Het
Pnliprp2 G T 19: 58,751,821 (GRCm39) V189L probably benign Het
Pole G A 5: 110,471,530 (GRCm39) V1425M possibly damaging Het
Pot1b T A 17: 55,961,805 (GRCm39) Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 (GRCm39) T301M possibly damaging Het
Psg21 T C 7: 18,384,741 (GRCm39) E335G probably benign Het
Ptpru T A 4: 131,497,066 (GRCm39) M1416L probably benign Het
Pxn T C 5: 115,683,049 (GRCm39) V117A probably damaging Het
Qsox1 C T 1: 155,688,385 (GRCm39) R54H possibly damaging Het
Rad1 A G 15: 10,488,092 (GRCm39) E42G probably damaging Het
Rpp14 A G 14: 8,090,145 (GRCm38) Y23C probably benign Het
Sdk2 C T 11: 113,725,782 (GRCm39) V1156I probably benign Het
Serpina3j G T 12: 104,285,958 (GRCm39) R371L probably benign Het
Serpinb9d T A 13: 33,381,946 (GRCm39) probably null Het
Sirt5 C T 13: 43,524,267 (GRCm39) S13F possibly damaging Het
Slc6a7 T A 18: 61,134,470 (GRCm39) probably benign Het
Slx4 A G 16: 3,804,712 (GRCm39) S701P probably benign Het
Snx29 A G 16: 11,185,545 (GRCm39) T43A probably benign Het
Speg T C 1: 75,400,550 (GRCm39) V2570A probably benign Het
Srrm4 T A 5: 116,591,565 (GRCm39) probably benign Het
Stk32a A G 18: 43,394,381 (GRCm39) Y110C probably damaging Het
Tbc1d31 G A 15: 57,779,506 (GRCm39) G73E probably benign Het
Thsd7a A T 6: 12,555,434 (GRCm39) I150N possibly damaging Het
Tjp1 A T 7: 64,969,001 (GRCm39) D699E probably damaging Het
Tmem143 A G 7: 45,565,988 (GRCm39) D437G possibly damaging Het
Tmem45a2 A G 16: 56,867,447 (GRCm39) Y85H possibly damaging Het
Tmem45b T A 9: 31,340,383 (GRCm39) T7S probably damaging Het
Tut4 T A 4: 108,407,922 (GRCm39) V1397D probably damaging Het
Ube4b A G 4: 149,432,428 (GRCm39) L832P probably damaging Het
Ugp2 G T 11: 21,279,048 (GRCm39) F379L probably damaging Het
Ugt3a1 A T 15: 9,365,437 (GRCm39) D350V probably damaging Het
Vmn2r8 T A 5: 108,950,284 (GRCm39) T188S possibly damaging Het
Vwa7 C G 17: 35,236,088 (GRCm39) P14R probably benign Het
Vwc2 C A 11: 11,211,495 (GRCm39) T317K probably damaging Het
Vwf A T 6: 125,605,335 (GRCm39) Q906L probably benign Het
Wdr49 A G 3: 75,336,654 (GRCm39) V351A probably damaging Het
Wdr7 A G 18: 63,861,575 (GRCm39) S196G probably benign Het
Xkr6 C A 14: 64,035,745 (GRCm39) A26E unknown Het
Zfp955b T C 17: 33,524,427 (GRCm39) I47V probably benign Het
Other mutations in Nadsyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Nadsyn1 APN 7 143,366,530 (GRCm39) missense probably damaging 1.00
IGL01359:Nadsyn1 APN 7 143,374,967 (GRCm39) missense possibly damaging 0.74
IGL01412:Nadsyn1 APN 7 143,362,527 (GRCm39) critical splice donor site probably null
IGL01481:Nadsyn1 APN 7 143,366,321 (GRCm39) missense probably damaging 1.00
IGL01642:Nadsyn1 APN 7 143,351,615 (GRCm39) missense probably damaging 1.00
IGL02110:Nadsyn1 APN 7 143,367,164 (GRCm39) missense probably damaging 1.00
IGL02126:Nadsyn1 APN 7 143,357,753 (GRCm39) nonsense probably null
IGL02173:Nadsyn1 APN 7 143,357,743 (GRCm39) splice site probably benign
IGL02351:Nadsyn1 APN 7 143,353,649 (GRCm39) missense probably damaging 1.00
IGL02358:Nadsyn1 APN 7 143,353,649 (GRCm39) missense probably damaging 1.00
IGL03216:Nadsyn1 APN 7 143,351,582 (GRCm39) missense probably damaging 1.00
R0029:Nadsyn1 UTSW 7 143,359,815 (GRCm39) missense probably benign 0.01
R0036:Nadsyn1 UTSW 7 143,365,028 (GRCm39) missense probably benign 0.23
R0968:Nadsyn1 UTSW 7 143,359,770 (GRCm39) missense probably benign 0.30
R1487:Nadsyn1 UTSW 7 143,360,662 (GRCm39) missense probably benign 0.31
R1694:Nadsyn1 UTSW 7 143,361,749 (GRCm39) missense probably benign 0.00
R4540:Nadsyn1 UTSW 7 143,356,960 (GRCm39) missense probably damaging 1.00
R4742:Nadsyn1 UTSW 7 143,352,367 (GRCm39) intron probably benign
R4755:Nadsyn1 UTSW 7 143,360,650 (GRCm39) missense probably damaging 1.00
R5045:Nadsyn1 UTSW 7 143,360,706 (GRCm39) missense probably damaging 1.00
R5288:Nadsyn1 UTSW 7 143,357,023 (GRCm39) missense possibly damaging 0.95
R5326:Nadsyn1 UTSW 7 143,362,567 (GRCm39) missense probably benign 0.42
R5666:Nadsyn1 UTSW 7 143,361,168 (GRCm39) missense probably damaging 1.00
R5669:Nadsyn1 UTSW 7 143,361,168 (GRCm39) missense probably damaging 1.00
R5691:Nadsyn1 UTSW 7 143,366,316 (GRCm39) splice site probably null
R5861:Nadsyn1 UTSW 7 143,364,964 (GRCm39) missense possibly damaging 0.80
R6213:Nadsyn1 UTSW 7 143,353,549 (GRCm39) missense probably benign 0.05
R6624:Nadsyn1 UTSW 7 143,359,710 (GRCm39) missense probably benign 0.02
R6652:Nadsyn1 UTSW 7 143,364,955 (GRCm39) missense probably benign 0.03
R6791:Nadsyn1 UTSW 7 143,372,845 (GRCm39) missense probably damaging 1.00
R7144:Nadsyn1 UTSW 7 143,364,952 (GRCm39) missense probably damaging 0.99
R7559:Nadsyn1 UTSW 7 143,361,804 (GRCm39) missense probably benign 0.00
R7770:Nadsyn1 UTSW 7 143,359,740 (GRCm39) missense probably damaging 1.00
R7802:Nadsyn1 UTSW 7 143,359,763 (GRCm39) missense probably benign
R7871:Nadsyn1 UTSW 7 143,352,233 (GRCm39) nonsense probably null
R9266:Nadsyn1 UTSW 7 143,369,348 (GRCm39) missense probably damaging 1.00
R9550:Nadsyn1 UTSW 7 143,353,615 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAAGGAGCTAAGTCTGCTTTAATC -3'
(R):5'- TGAAACCCGTGTGTCCCTTG -3'

Sequencing Primer
(F):5'- TACAAGTTTGAGCCCTGCAG -3'
(R):5'- TTGCCCACCAGGTAGCTGAG -3'
Posted On 2014-06-30