Incidental Mutation 'R1874:Lpl'
Institutional Source Beutler Lab
Gene Symbol Lpl
Ensembl Gene ENSMUSG00000015568
Gene Namelipoprotein lipase
SynonymsO 1-4-5
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1874 (G1)
Quality Score225
Status Validated
Chromosomal Location68880491-68907448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68896619 bp
Amino Acid Change Cysteine to Serine at position 266 (C266S)
Ref Sequence ENSEMBL: ENSMUSP00000132259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015712] [ENSMUST00000168401]
Predicted Effect probably damaging
Transcript: ENSMUST00000015712
AA Change: C266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015712
Gene: ENSMUSG00000015568
AA Change: C266S

Pfam:Lipase 19 338 7.8e-133 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168401
AA Change: C266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132259
Gene: ENSMUSG00000015568
AA Change: C266S

Pfam:Lipase 19 338 1.1e-117 PFAM
Pfam:Abhydrolase_6 76 264 3e-10 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169749
Meta Mutation Damage Score 0.9749 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LPL encodes lipoprotein lipase, which is expressed in heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia, while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations become cyanotic and die within 2 days of birth due to chylomicron engorgement of capillaries. Mutants show hypertriglyceridemia and reduced fat stores. Heterozygotes show 1.5-2-fold elevated triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Lpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Lpl APN 8 68902366 missense probably benign 0.00
IGL01161:Lpl APN 8 68892625 nonsense probably null
IGL01370:Lpl APN 8 68887568 missense possibly damaging 0.92
IGL01420:Lpl APN 8 68887433 splice site probably benign
IGL02034:Lpl APN 8 68880772 missense possibly damaging 0.64
IGL02227:Lpl APN 8 68895800 missense probably damaging 0.99
IGL02949:Lpl APN 8 68892748 missense probably damaging 1.00
IGL03237:Lpl APN 8 68894726 missense possibly damaging 0.90
Bensadoun UTSW 8 68896807 missense probably benign 0.03
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0490:Lpl UTSW 8 68896691 missense probably damaging 0.98
R1252:Lpl UTSW 8 68892659 missense probably benign 0.03
R1331:Lpl UTSW 8 68896629 missense probably damaging 0.99
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1444:Lpl UTSW 8 68892747 missense probably damaging 0.99
R1722:Lpl UTSW 8 68896602 frame shift probably null
R1826:Lpl UTSW 8 68902291 missense possibly damaging 0.62
R1867:Lpl UTSW 8 68896602 frame shift probably null
R1970:Lpl UTSW 8 68896802 nonsense probably null
R2401:Lpl UTSW 8 68901243 missense possibly damaging 0.52
R2516:Lpl UTSW 8 68887518 missense probably benign 0.00
R2850:Lpl UTSW 8 68899512 nonsense probably null
R4688:Lpl UTSW 8 68899425 missense probably damaging 1.00
R4773:Lpl UTSW 8 68896751 missense probably damaging 1.00
R4962:Lpl UTSW 8 68894693 missense probably damaging 1.00
R4993:Lpl UTSW 8 68895793 missense probably benign 0.23
R5343:Lpl UTSW 8 68895737 missense probably damaging 1.00
R6018:Lpl UTSW 8 68901288 missense probably benign
R6082:Lpl UTSW 8 68896649 missense probably damaging 0.98
R6137:Lpl UTSW 8 68892747 missense probably damaging 0.99
R6589:Lpl UTSW 8 68896807 missense probably benign 0.03
R7730:Lpl UTSW 8 68887448 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-06-30