Incidental Mutation 'R1874:Oprm1'
ID 211060
Institutional Source Beutler Lab
Gene Symbol Oprm1
Ensembl Gene ENSMUSG00000000766
Gene Name opioid receptor, mu 1
Synonyms MOP-R, MOR-1, MOP receptor, mor, Oprm, muOR
MMRRC Submission 039896-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 6708593-6988209 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6739035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 54 (H54R)
Ref Sequence ENSEMBL: ENSMUSP00000120187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000783] [ENSMUST00000052751] [ENSMUST00000056385] [ENSMUST00000063036] [ENSMUST00000078634] [ENSMUST00000092729] [ENSMUST00000092731] [ENSMUST00000092734] [ENSMUST00000105607] [ENSMUST00000105602] [ENSMUST00000105605] [ENSMUST00000105603] [ENSMUST00000105601] [ENSMUST00000105604] [ENSMUST00000105611] [ENSMUST00000123861] [ENSMUST00000105597] [ENSMUST00000105615] [ENSMUST00000129954] [ENSMUST00000152674] [ENSMUST00000144264] [ENSMUST00000135502] [ENSMUST00000154906] [ENSMUST00000150374] [ENSMUST00000154941] [ENSMUST00000129221] [ENSMUST00000143875] [ENSMUST00000147171]
AlphaFold P42866
Predicted Effect probably benign
Transcript: ENSMUST00000000783
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000783
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.3e-10 PFAM
Pfam:7tm_1 85 336 4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052751
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056385
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060590
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078634
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077704
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 2.4e-10 PFAM
Pfam:7tm_1 85 336 9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092729
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090405
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092731
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090407
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092734
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090410
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105607
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101232
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105602
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101227
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105605
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101230
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105603
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101228
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 6.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105601
AA Change: H54R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105604
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101229
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 5.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.8e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105611
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123861
AA Change: H54R

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105597
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129954
AA Change: H54R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152674
AA Change: H54R

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115552
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 94 8e-8 SMART
PDB:4DKL|A 52 94 7e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000144264
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154906
AA Change: H54R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114342
Gene: ENSMUSG00000000766
AA Change: H54R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 1.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.1e-10 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148625
Predicted Effect probably benign
Transcript: ENSMUST00000150374
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143875
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,670,428 (GRCm39) S217G probably benign Het
Adrb3 C A 8: 27,717,591 (GRCm39) R286L probably damaging Het
Akap11 T A 14: 78,749,306 (GRCm39) D1027V probably benign Het
Ank3 A T 10: 69,733,913 (GRCm39) I726F probably damaging Het
Ankmy2 T A 12: 36,215,930 (GRCm39) D43E possibly damaging Het
Ankrd34b A G 13: 92,576,064 (GRCm39) D432G probably damaging Het
Ano3 A C 2: 110,715,217 (GRCm39) S74A probably benign Het
B4galnt4 T A 7: 140,650,439 (GRCm39) S769T probably damaging Het
Bicral T A 17: 47,136,104 (GRCm39) T369S probably benign Het
Blm A G 7: 80,147,166 (GRCm39) L738P probably damaging Het
Bpifb3 A G 2: 153,767,760 (GRCm39) T278A probably benign Het
Bpifb5 A G 2: 154,069,122 (GRCm39) probably benign Het
Brd8 G C 18: 34,743,527 (GRCm39) P266R probably damaging Het
Btaf1 A T 19: 36,957,983 (GRCm39) M587L probably benign Het
Casz1 C G 4: 149,027,668 (GRCm39) T1015S probably damaging Het
Cdh23 A G 10: 60,272,597 (GRCm39) I524T possibly damaging Het
Celsr3 T C 9: 108,713,037 (GRCm39) V1825A probably benign Het
Cenpf A G 1: 189,416,013 (GRCm39) L104P probably damaging Het
Clasp1 G T 1: 118,528,315 (GRCm39) probably null Het
Coprs A G 8: 13,935,112 (GRCm39) W148R probably damaging Het
Cpne1 A G 2: 155,920,302 (GRCm39) S168P probably damaging Het
Cpxm2 T C 7: 131,661,563 (GRCm39) Y408C probably damaging Het
Ctnna3 A G 10: 63,339,886 (GRCm39) E24G possibly damaging Het
Cubn T A 2: 13,327,813 (GRCm39) S2671C probably damaging Het
Cyp4f39 T A 17: 32,702,298 (GRCm39) F265Y probably damaging Het
Dgkq C A 5: 108,808,461 (GRCm39) R34L probably benign Het
Dnajc7 C T 11: 100,490,139 (GRCm39) probably benign Het
Eml6 T G 11: 29,781,136 (GRCm39) D632A probably damaging Het
Fbxl18 G A 5: 142,871,978 (GRCm39) A419V probably damaging Het
Fbxw22 A T 9: 109,214,179 (GRCm39) C212* probably null Het
Ffar2 A G 7: 30,518,839 (GRCm39) probably null Het
Fga A T 3: 82,940,028 (GRCm39) T561S probably damaging Het
Fry A G 5: 150,269,386 (GRCm39) Y159C probably damaging Het
Gal3st1 A G 11: 3,948,231 (GRCm39) Y146C probably damaging Het
Gapvd1 A T 2: 34,596,033 (GRCm39) H788Q probably damaging Het
Gimap7 G A 6: 48,700,449 (GRCm39) V12I possibly damaging Het
Gli2 C A 1: 118,929,779 (GRCm39) A43S possibly damaging Het
Gm15446 T C 5: 110,090,419 (GRCm39) F224L probably damaging Het
Gm21738 C T 14: 19,418,824 (GRCm38) V35I possibly damaging Het
Grhl1 T C 12: 24,636,155 (GRCm39) probably benign Het
Grk6 T C 13: 55,598,086 (GRCm39) Y53H probably damaging Het
Hcar1 C T 5: 124,017,328 (GRCm39) R121K probably damaging Het
Hmcn1 A C 1: 150,596,446 (GRCm39) S1797A probably damaging Het
Hsd17b7 A T 1: 169,783,562 (GRCm39) L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,267,574 (GRCm39) probably null Het
Kif1b C T 4: 149,272,089 (GRCm39) V1571I probably benign Het
Lpl T A 8: 69,349,271 (GRCm39) C266S probably damaging Het
Mag G A 7: 30,608,476 (GRCm39) H213Y probably benign Het
Mansc4 T G 6: 146,976,688 (GRCm39) R309S probably benign Het
Mlh3 A G 12: 85,284,287 (GRCm39) probably null Het
Mndal G A 1: 173,687,933 (GRCm39) probably benign Het
Mrgpra2b T A 7: 47,113,742 (GRCm39) E330V probably damaging Het
Myh3 A G 11: 66,984,005 (GRCm39) I990V probably benign Het
Myoz2 A T 3: 122,819,765 (GRCm39) S65T probably damaging Het
Naa16 T C 14: 79,593,183 (GRCm39) E463G possibly damaging Het
Nadsyn1 A G 7: 143,351,581 (GRCm39) F684S probably damaging Het
Notch1 T C 2: 26,371,591 (GRCm39) E286G possibly damaging Het
Nynrin A T 14: 56,100,950 (GRCm39) I247L probably benign Het
Or10g6 T A 9: 39,934,151 (GRCm39) I154N possibly damaging Het
Or2n1d C T 17: 38,646,860 (GRCm39) P271S probably damaging Het
Or51a43 T C 7: 103,717,336 (GRCm39) I301V probably null Het
P4hb C T 11: 120,452,992 (GRCm39) D483N probably benign Het
Pak1 T C 7: 97,520,787 (GRCm39) S149P probably benign Het
Pars2 T C 4: 106,510,913 (GRCm39) F232L possibly damaging Het
Pih1d2 A G 9: 50,532,245 (GRCm39) M88V possibly damaging Het
Pms1 A T 1: 53,246,392 (GRCm39) N382K probably benign Het
Pnliprp2 G T 19: 58,751,821 (GRCm39) V189L probably benign Het
Pole G A 5: 110,471,530 (GRCm39) V1425M possibly damaging Het
Pot1b T A 17: 55,961,805 (GRCm39) Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 (GRCm39) T301M possibly damaging Het
Psg21 T C 7: 18,384,741 (GRCm39) E335G probably benign Het
Ptpru T A 4: 131,497,066 (GRCm39) M1416L probably benign Het
Pxn T C 5: 115,683,049 (GRCm39) V117A probably damaging Het
Qsox1 C T 1: 155,688,385 (GRCm39) R54H possibly damaging Het
Rad1 A G 15: 10,488,092 (GRCm39) E42G probably damaging Het
Rpp14 A G 14: 8,090,145 (GRCm38) Y23C probably benign Het
Sdk2 C T 11: 113,725,782 (GRCm39) V1156I probably benign Het
Serpina3j G T 12: 104,285,958 (GRCm39) R371L probably benign Het
Serpinb9d T A 13: 33,381,946 (GRCm39) probably null Het
Sirt5 C T 13: 43,524,267 (GRCm39) S13F possibly damaging Het
Slc6a7 T A 18: 61,134,470 (GRCm39) probably benign Het
Slx4 A G 16: 3,804,712 (GRCm39) S701P probably benign Het
Snx29 A G 16: 11,185,545 (GRCm39) T43A probably benign Het
Speg T C 1: 75,400,550 (GRCm39) V2570A probably benign Het
Srrm4 T A 5: 116,591,565 (GRCm39) probably benign Het
Stk32a A G 18: 43,394,381 (GRCm39) Y110C probably damaging Het
Tbc1d31 G A 15: 57,779,506 (GRCm39) G73E probably benign Het
Thsd7a A T 6: 12,555,434 (GRCm39) I150N possibly damaging Het
Tjp1 A T 7: 64,969,001 (GRCm39) D699E probably damaging Het
Tmem143 A G 7: 45,565,988 (GRCm39) D437G possibly damaging Het
Tmem45a2 A G 16: 56,867,447 (GRCm39) Y85H possibly damaging Het
Tmem45b T A 9: 31,340,383 (GRCm39) T7S probably damaging Het
Tut4 T A 4: 108,407,922 (GRCm39) V1397D probably damaging Het
Ube4b A G 4: 149,432,428 (GRCm39) L832P probably damaging Het
Ugp2 G T 11: 21,279,048 (GRCm39) F379L probably damaging Het
Ugt3a1 A T 15: 9,365,437 (GRCm39) D350V probably damaging Het
Vmn2r8 T A 5: 108,950,284 (GRCm39) T188S possibly damaging Het
Vwa7 C G 17: 35,236,088 (GRCm39) P14R probably benign Het
Vwc2 C A 11: 11,211,495 (GRCm39) T317K probably damaging Het
Vwf A T 6: 125,605,335 (GRCm39) Q906L probably benign Het
Wdr49 A G 3: 75,336,654 (GRCm39) V351A probably damaging Het
Wdr7 A G 18: 63,861,575 (GRCm39) S196G probably benign Het
Xkr6 C A 14: 64,035,745 (GRCm39) A26E unknown Het
Zfp955b T C 17: 33,524,427 (GRCm39) I47V probably benign Het
Other mutations in Oprm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Oprm1 APN 10 6,987,170 (GRCm39) utr 3 prime probably benign
IGL01768:Oprm1 APN 10 6,779,186 (GRCm39) missense probably damaging 1.00
IGL02455:Oprm1 APN 10 6,780,219 (GRCm39) missense probably damaging 1.00
IGL03391:Oprm1 APN 10 6,964,077 (GRCm39) intron probably benign
IGL03410:Oprm1 APN 10 6,780,051 (GRCm39) missense probably damaging 1.00
IGL03048:Oprm1 UTSW 10 6,779,064 (GRCm39) missense probably damaging 1.00
R0189:Oprm1 UTSW 10 6,739,071 (GRCm39) missense possibly damaging 0.94
R0321:Oprm1 UTSW 10 6,779,183 (GRCm39) missense probably damaging 1.00
R0629:Oprm1 UTSW 10 6,782,604 (GRCm39) splice site probably null
R0730:Oprm1 UTSW 10 6,782,652 (GRCm39) intron probably benign
R1542:Oprm1 UTSW 10 6,738,960 (GRCm39) missense probably damaging 1.00
R1743:Oprm1 UTSW 10 6,780,105 (GRCm39) missense probably damaging 0.99
R2864:Oprm1 UTSW 10 6,744,226 (GRCm39) splice site probably null
R2964:Oprm1 UTSW 10 6,738,914 (GRCm39) missense probably damaging 0.98
R3792:Oprm1 UTSW 10 6,789,544 (GRCm39) missense probably benign 0.00
R4008:Oprm1 UTSW 10 6,782,520 (GRCm39) missense probably benign
R4049:Oprm1 UTSW 10 6,779,087 (GRCm39) missense probably benign 0.36
R4088:Oprm1 UTSW 10 6,780,234 (GRCm39) missense probably damaging 1.00
R4724:Oprm1 UTSW 10 6,708,656 (GRCm39) nonsense probably null
R4812:Oprm1 UTSW 10 6,782,698 (GRCm39) intron probably benign
R4822:Oprm1 UTSW 10 6,779,036 (GRCm39) missense probably damaging 0.99
R4855:Oprm1 UTSW 10 6,788,468 (GRCm39) missense probably benign 0.01
R5072:Oprm1 UTSW 10 6,782,550 (GRCm39) missense probably benign 0.15
R5768:Oprm1 UTSW 10 6,739,026 (GRCm39) missense probably damaging 1.00
R5770:Oprm1 UTSW 10 6,739,026 (GRCm39) missense probably damaging 1.00
R5995:Oprm1 UTSW 10 6,782,520 (GRCm39) missense probably benign
R6327:Oprm1 UTSW 10 6,780,063 (GRCm39) missense probably damaging 0.99
R7135:Oprm1 UTSW 10 6,780,203 (GRCm39) missense possibly damaging 0.77
R7413:Oprm1 UTSW 10 6,778,919 (GRCm39) missense probably damaging 1.00
R7455:Oprm1 UTSW 10 6,780,204 (GRCm39) missense probably damaging 1.00
R8192:Oprm1 UTSW 10 6,788,417 (GRCm39) missense probably benign 0.04
R8210:Oprm1 UTSW 10 6,780,442 (GRCm39) missense probably benign 0.02
R8945:Oprm1 UTSW 10 6,782,644 (GRCm39) intron probably benign
R9054:Oprm1 UTSW 10 6,773,914 (GRCm39) intron probably benign
R9723:Oprm1 UTSW 10 6,788,514 (GRCm39) missense possibly damaging 0.66
R9726:Oprm1 UTSW 10 6,929,694 (GRCm39) missense probably benign 0.00
X0066:Oprm1 UTSW 10 6,780,462 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTCAGTTACAGCCTACC -3'
(R):5'- CTCCTCTGTCACTCATGGGG -3'

Sequencing Primer
(F):5'- TCAGTTACAGCCTACCGAGTC -3'
(R):5'- CACTCATGGGGGAGCTTTGTC -3'
Posted On 2014-06-30