Incidental Mutation 'R1874:Cdh23'
ID 211061
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Name cadherin 23 (otocadherin)
Synonyms nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock # R1874 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 60302748-60696490 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60436818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 524 (I524T)
Ref Sequence ENSEMBL: ENSMUSP00000101104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073242
AA Change: I526T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: I526T

signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105461
AA Change: I526T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: I526T

signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105462
AA Change: I529T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: I529T

signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105463
AA Change: I526T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: I526T

signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105464
AA Change: I524T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: I524T

signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Meta Mutation Damage Score 0.1457 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Slx4 A G 16: 3,986,848 S701P probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
hersey UTSW 10 60308036 missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7009:Cdh23 UTSW 10 60337306 missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60384945 missense probably benign 0.17
R7573:Cdh23 UTSW 10 60323550 missense probably benign 0.17
R7578:Cdh23 UTSW 10 60407407 missense probably benign 0.14
R7646:Cdh23 UTSW 10 60305152 missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60337264 missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60312577 missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60385194 missense probably benign 0.07
R7867:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R7878:Cdh23 UTSW 10 60314200 missense possibly damaging 0.69
R7915:Cdh23 UTSW 10 60307889 missense probably damaging 0.97
R7922:Cdh23 UTSW 10 60382706 missense probably benign 0.31
R7963:Cdh23 UTSW 10 60336188 missense probably damaging 1.00
R7997:Cdh23 UTSW 10 60596739 missense possibly damaging 0.81
R8167:Cdh23 UTSW 10 60314383 missense probably benign 0.12
R8167:Cdh23 UTSW 10 60337693 missense probably damaging 0.96
R8258:Cdh23 UTSW 10 60315656 missense probably damaging 0.99
R8259:Cdh23 UTSW 10 60315656 missense probably damaging 0.99
R8317:Cdh23 UTSW 10 60311258 critical splice donor site probably null
R8317:Cdh23 UTSW 10 60436789 missense probably damaging 1.00
R8326:Cdh23 UTSW 10 60438812 missense possibly damaging 0.55
R8333:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R8348:Cdh23 UTSW 10 60331728 missense probably benign 0.43
R8366:Cdh23 UTSW 10 60325020 missense probably benign
R8504:Cdh23 UTSW 10 60438839 missense probably benign 0.00
R8676:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R8781:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R8785:Cdh23 UTSW 10 60311335 missense probably damaging 1.00
R8788:Cdh23 UTSW 10 60488593 missense probably damaging 1.00
R8802:Cdh23 UTSW 10 60409098 missense probably benign 0.04
R8837:Cdh23 UTSW 10 60324976 missense probably benign 0.28
R8863:Cdh23 UTSW 10 60376834 nonsense probably null
R8889:Cdh23 UTSW 10 60307505 missense probably damaging 0.97
R8892:Cdh23 UTSW 10 60307505 missense probably damaging 0.97
R8921:Cdh23 UTSW 10 60305129 missense probably damaging 0.99
R8980:Cdh23 UTSW 10 60337846 missense probably benign 0.06
R9000:Cdh23 UTSW 10 60304498 missense possibly damaging 0.82
R9043:Cdh23 UTSW 10 60315699 missense probably benign 0.00
R9070:Cdh23 UTSW 10 60337760 missense probably benign
R9075:Cdh23 UTSW 10 60317762 missense probably damaging 1.00
R9132:Cdh23 UTSW 10 60434504 splice site probably benign
R9155:Cdh23 UTSW 10 60413706 missense probably damaging 0.99
R9171:Cdh23 UTSW 10 60326031 missense probably benign 0.00
R9179:Cdh23 UTSW 10 60317885 missense probably benign 0.06
R9186:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9189:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9207:Cdh23 UTSW 10 60407431 missense probably damaging 1.00
R9240:Cdh23 UTSW 10 60379265 missense probably benign 0.00
R9244:Cdh23 UTSW 10 60413663 missense possibly damaging 0.93
R9284:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9286:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9287:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9302:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9352:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9353:Cdh23 UTSW 10 60307527 missense possibly damaging 0.54
R9423:Cdh23 UTSW 10 60312608 missense probably damaging 1.00
R9513:Cdh23 UTSW 10 60331216 missense probably damaging 0.99
R9577:Cdh23 UTSW 10 60311116 missense probably damaging 1.00
R9598:Cdh23 UTSW 10 60378795 missense probably benign 0.01
R9631:Cdh23 UTSW 10 60407389 missense possibly damaging 0.49
R9725:Cdh23 UTSW 10 60596782 missense not run
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Z1176:Cdh23 UTSW 10 60310770 missense probably damaging 1.00
Z1176:Cdh23 UTSW 10 60428321 missense probably benign
Z1177:Cdh23 UTSW 10 60323555 missense possibly damaging 0.80
Z1177:Cdh23 UTSW 10 60434614 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-06-30