Mutagenetix > Incidental Mutation

Incidental Mutation 'R1874:Sdk2'

211071

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

039896-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R1874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 113834956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1156 (V1156I)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably benign
Transcript: ENSMUST00000041627
AA Change: V1156I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: V1156I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 94.1%

Validation Efficiency

96% (105/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,742,691	S217G	probably benign	Het
Adrb3	C	A	8: 27,227,563	R286L	probably damaging	Het
Akap11	T	A	14: 78,511,866	D1027V	probably benign	Het
Ank3	A	T	10: 69,898,083	I726F	probably damaging	Het
Ankmy2	T	A	12: 36,165,931	D43E	possibly damaging	Het
Ankrd34b	A	G	13: 92,439,556	D432G	probably damaging	Het
Ano3	A	C	2: 110,884,872	S74A	probably benign	Het
B4galnt4	T	A	7: 141,070,526	S769T	probably damaging	Het
Bicral	T	A	17: 46,825,178	T369S	probably benign	Het
Blm	A	G	7: 80,497,418	L738P	probably damaging	Het
Bpifb3	A	G	2: 153,925,840	T278A	probably benign	Het
Bpifb5	A	G	2: 154,227,202		probably benign	Het
Brd8	G	C	18: 34,610,474	P266R	probably damaging	Het
Btaf1	A	T	19: 36,980,583	M587L	probably benign	Het
Casz1	C	G	4: 148,943,211	T1015S	probably damaging	Het
Cdh23	A	G	10: 60,436,818	I524T	possibly damaging	Het
Celsr3	T	C	9: 108,835,838	V1825A	probably benign	Het
Cenpf	A	G	1: 189,683,816	L104P	probably damaging	Het
Clasp1	G	T	1: 118,600,585		probably null	Het
Coprs	A	G	8: 13,885,112	W148R	probably damaging	Het
Cpne1	A	G	2: 156,078,382	S168P	probably damaging	Het
Cpxm2	T	C	7: 132,059,834	Y408C	probably damaging	Het
Ctnna3	A	G	10: 63,504,107	E24G	possibly damaging	Het
Cubn	T	A	2: 13,323,002	S2671C	probably damaging	Het
Cyp4f39	T	A	17: 32,483,324	F265Y	probably damaging	Het
Dgkq	C	A	5: 108,660,595	R34L	probably benign	Het
Dnajc7	C	T	11: 100,599,313		probably benign	Het
Eml6	T	G	11: 29,831,136	D632A	probably damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fbxw22	A	T	9: 109,385,111	C212*	probably null	Het
Ffar2	A	G	7: 30,819,414		probably null	Het
Fga	A	T	3: 83,032,721	T561S	probably damaging	Het
Fry	A	G	5: 150,345,921	Y159C	probably damaging	Het
Gal3st1	A	G	11: 3,998,231	Y146C	probably damaging	Het
Gapvd1	A	T	2: 34,706,021	H788Q	probably damaging	Het
Gimap7	G	A	6: 48,723,515	V12I	possibly damaging	Het
Gli2	C	A	1: 119,002,049	A43S	possibly damaging	Het
Gm15446	T	C	5: 109,942,553	F224L	probably damaging	Het
Gm21738	C	T	14: 19,418,824	V35I	possibly damaging	Het
Grhl1	T	C	12: 24,586,156		probably benign	Het
Grk6	T	C	13: 55,450,273	Y53H	probably damaging	Het
Hcar1	C	T	5: 123,879,265	R121K	probably damaging	Het
Hmcn1	A	C	1: 150,720,695	S1797A	probably damaging	Het
Hsd17b7	A	T	1: 169,955,993	L282Q	possibly damaging	Het
Irs1	TTCTCTGAGTGGCCACAGCGTCT	TTCT	1: 82,289,853		probably null	Het
Kif1b	C	T	4: 149,187,632	V1571I	probably benign	Het
Lpl	T	A	8: 68,896,619	C266S	probably damaging	Het
Mag	G	A	7: 30,909,051	H213Y	probably benign	Het
Mansc4	T	G	6: 147,075,190	R309S	probably benign	Het
Mlh3	A	G	12: 85,237,513		probably null	Het
Mndal	G	A	1: 173,860,367		probably benign	Het
Mrgpra2b	T	A	7: 47,463,994	E330V	probably damaging	Het
Myh3	A	G	11: 67,093,179	I990V	probably benign	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Naa16	T	C	14: 79,355,743	E463G	possibly damaging	Het
Nadsyn1	A	G	7: 143,797,844	F684S	probably damaging	Het
Notch1	T	C	2: 26,481,579	E286G	possibly damaging	Het
Nynrin	A	T	14: 55,863,493	I247L	probably benign	Het
Olfr136	C	T	17: 38,335,969	P271S	probably damaging	Het
Olfr644	T	C	7: 104,068,129	I301V	probably null	Het
Olfr981	T	A	9: 40,022,855	I154N	possibly damaging	Het
Oprm1	A	G	10: 6,789,035	H54R	probably benign	Het
P4hb	C	T	11: 120,562,166	D483N	probably benign	Het
Pak1	T	C	7: 97,871,580	S149P	probably benign	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pih1d2	A	G	9: 50,620,945	M88V	possibly damaging	Het
Pms1	A	T	1: 53,207,233	N382K	probably benign	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Pole	G	A	5: 110,323,664	V1425M	possibly damaging	Het
Pot1b	T	A	17: 55,654,805	Q591L	probably benign	Het
Ppp1r9a	C	T	6: 4,906,348	T301M	possibly damaging	Het
Psg21	T	C	7: 18,650,816	E335G	probably benign	Het
Ptpru	T	A	4: 131,769,755	M1416L	probably benign	Het
Pxn	T	C	5: 115,544,990	V117A	probably damaging	Het
Qsox1	C	T	1: 155,812,639	R54H	possibly damaging	Het
Rad1	A	G	15: 10,488,006	E42G	probably damaging	Het
Rpp14	A	G	14: 8,090,145	Y23C	probably benign	Het
Serpina3j	G	T	12: 104,319,699	R371L	probably benign	Het
Serpinb9d	T	A	13: 33,197,963		probably null	Het
Sirt5	C	T	13: 43,370,791	S13F	possibly damaging	Het
Slc6a7	T	A	18: 61,001,398		probably benign	Het
Slx4	A	G	16: 3,986,848	S701P	probably benign	Het
Snx29	A	G	16: 11,367,681	T43A	probably benign	Het
Speg	T	C	1: 75,423,906	V2570A	probably benign	Het
Srrm4	T	A	5: 116,453,506		probably benign	Het
Stk32a	A	G	18: 43,261,316	Y110C	probably damaging	Het
Tbc1d31	G	A	15: 57,916,110	G73E	probably benign	Het
Thsd7a	A	T	6: 12,555,435	I150N	possibly damaging	Het
Tjp1	A	T	7: 65,319,253	D699E	probably damaging	Het
Tmem143	A	G	7: 45,916,564	D437G	possibly damaging	Het
Tmem45a2	A	G	16: 57,047,084	Y85H	possibly damaging	Het
Tmem45b	T	A	9: 31,429,087	T7S	probably damaging	Het
Ube4b	A	G	4: 149,347,971	L832P	probably damaging	Het
Ugp2	G	T	11: 21,329,048	F379L	probably damaging	Het
Ugt3a2	A	T	15: 9,365,351	D350V	probably damaging	Het
Vmn2r8	T	A	5: 108,802,418	T188S	possibly damaging	Het
Vwa7	C	G	17: 35,017,112	P14R	probably benign	Het
Vwc2	C	A	11: 11,261,495	T317K	probably damaging	Het
Vwf	A	T	6: 125,628,372	Q906L	probably benign	Het
Wdr49	A	G	3: 75,429,347	V351A	probably damaging	Het
Wdr7	A	G	18: 63,728,504	S196G	probably benign	Het
Xkr6	C	A	14: 63,798,296	A26E	unknown	Het
Zcchc11	T	A	4: 108,550,725	V1397D	probably damaging	Het
Zfp955b	T	C	17: 33,305,453	I47V	probably benign	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAGCTGTCTGTAGAAATGGCCAC -3'
(R):5'- CACTGGCTGCTCAACTTGTG -3'

Sequencing Primer
(F):5'- TCTGTAGAAATGGCCACAGCATG -3'
(R):5'- CTCAACTTGTGGGTGGGAAAG -3'

Posted On

2014-06-30