Incidental Mutation 'R1875:Atp11b'
ID211115
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35839147 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 883 (L883P)
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
Predicted Effect probably damaging
Transcript: ENSMUST00000029257
AA Change: L1083P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: L1083P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect unknown
Transcript: ENSMUST00000197764
AA Change: L31P
Predicted Effect probably damaging
Transcript: ENSMUST00000198599
AA Change: L883P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: L883P

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000211902
AA Change: L33P
Meta Mutation Damage Score 0.9263 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 unclassified probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 unclassified probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 unclassified probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5807:Atp11b UTSW 3 35812279 missense probably damaging 1.00
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCTGGCACTCTTAAAGTTG -3'
(R):5'- TGCTGTAGTTTAGAGACATGGTCAC -3'

Sequencing Primer
(F):5'- AAACAGTGTCTCCCTATGTAGGC -3'
(R):5'- CTGTTCTAACTGAAGAGTTACTG -3'
Posted On2014-06-30