Incidental Mutation 'R1875:Pars2'
ID211122
Institutional Source Beutler Lab
Gene Symbol Pars2
Ensembl Gene ENSMUSG00000043572
Gene Nameprolyl-tRNA synthetase (mitochondrial)(putative)
Synonyms
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106651069-106655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106653716 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 232 (F232L)
Ref Sequence ENSEMBL: ENSMUSP00000102393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058905] [ENSMUST00000106781] [ENSMUST00000106782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058905
AA Change: F196L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053160
Gene: ENSMUSG00000043572
AA Change: F196L

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 98 268 4.8e-36 PFAM
Pfam:HGTP_anticodon 371 470 8.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106781
AA Change: F232L

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102393
Gene: ENSMUSG00000043572
AA Change: F232L

DomainStartEndE-ValueType
Pfam:tRNA-synt_2b 178 391 4.1e-36 PFAM
Pfam:HGTP_anticodon 407 506 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106782
SMART Domains Protein: ENSMUSP00000102394
Gene: ENSMUSG00000043572

DomainStartEndE-ValueType
PDB:2I4O|C 63 162 2e-8 PDB
SCOP:d1atia2 95 162 4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146966
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of proline to tRNA molecules. Mutations have been found in this gene in some patients with Alpers syndrome. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Pars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pars2 APN 4 106654050 missense probably damaging 0.99
IGL03358:Pars2 APN 4 106653042 missense probably benign 0.00
PIT4378001:Pars2 UTSW 4 106654293 missense possibly damaging 0.51
R1384:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R1874:Pars2 UTSW 4 106653716 missense possibly damaging 0.75
R2041:Pars2 UTSW 4 106653617 missense probably damaging 1.00
R4606:Pars2 UTSW 4 106654050 missense probably benign 0.22
R4790:Pars2 UTSW 4 106651111 utr 5 prime probably benign
R4794:Pars2 UTSW 4 106654210 nonsense probably null
R5162:Pars2 UTSW 4 106654538 missense probably benign 0.00
R6066:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R6730:Pars2 UTSW 4 106653431 missense probably damaging 1.00
R6860:Pars2 UTSW 4 106654503 missense probably benign 0.45
R7710:Pars2 UTSW 4 106654079 missense probably damaging 1.00
R7712:Pars2 UTSW 4 106654079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGAAAATCAACATGCC -3'
(R):5'- ACTGGTAGCTGGAATTCATGGG -3'

Sequencing Primer
(F):5'- TGGGACCTGATGGGCAG -3'
(R):5'- GACATCGTGCCCCCGATG -3'
Posted On2014-06-30