Mutagenetix > Incidental Mutations

Incidental Mutation 'R1875:Plch2'

211125

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

039897-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1875 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 154998508 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 485 (S485F)

Ref Sequence

ENSEMBL: ENSMUSP00000119864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]

Predicted Effect

probably damaging
Transcript: ENSMUST00000105631
AA Change: S561F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: S561F

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	1.7e-26	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1088	1107	N/A	INTRINSIC
low complexity region	1227	1236	N/A	INTRINSIC
low complexity region	1356	1369	N/A	INTRINSIC
low complexity region	1421	1451	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127661

Predicted Effect

probably damaging
Transcript: ENSMUST00000135665
AA Change: S456F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: S456F

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139976
AA Change: S561F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: S561F

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	3.2e-27	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1087	1100	N/A	INTRINSIC
low complexity region	1166	1194	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000145662
AA Change: S485F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055
AA Change: S485F

Domain	Start	End	E-Value	Type
PH	46	155	1.8e-6	SMART
EFh	171	199	7.29e-4	SMART
EFh	207	236	4.67e-2	SMART
Pfam:EF-hand_like	241	323	5.2e-27	PFAM
PLCXc	324	469	6.76e-76	SMART
low complexity region	483	496	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175982
AA Change: S345F

Predicted Effect

probably damaging
Transcript: ENSMUST00000176194
AA Change: S460F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: S460F

Domain	Start	End	E-Value	Type
PH	21	130	1.8e-6	SMART
EFh	146	174	7.29e-4	SMART
EFh	182	211	4.67e-2	SMART
Pfam:EF-hand_like	216	298	1.6e-25	PFAM
PLCXc	299	444	6.76e-76	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
PLCYc	606	720	1.25e-56	SMART
C2	739	847	1.66e-21	SMART
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1065	1093	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186598

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Meta Mutation Damage Score

0.1752

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.1%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,358	D772G	probably damaging	Het
Abca14	A	T	7: 120,247,967	M685L	possibly damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Adam26a	C	A	8: 43,569,851	V201L	probably benign	Het
Adamts20	G	T	15: 94,331,396	D947E	probably benign	Het
Ankrd26	A	G	6: 118,540,449		probably null	Het
Apol11a	C	A	15: 77,513,566	T39N	possibly damaging	Het
Arhgef38	T	A	3: 133,133,740		probably null	Het
Atp11b	T	C	3: 35,839,147	L883P	probably damaging	Het
Btnl10	T	A	11: 58,923,760	I422N	probably damaging	Het
C2cd3	A	G	7: 100,407,025	K547E	possibly damaging	Het
Cdh2	T	A	18: 16,624,877	L549F	probably benign	Het
Celsr3	T	C	9: 108,835,838	V1825A	probably benign	Het
Cfap221	T	C	1: 119,953,659	I358V	probably benign	Het
Csmd1	T	C	8: 15,929,101	K2828E	probably damaging	Het
Ddah2	T	C	17: 35,060,845	F137S	probably damaging	Het
Ddx21	A	G	10: 62,594,068	I299T	probably damaging	Het
Dnah7a	A	T	1: 53,456,532		probably benign	Het
Elmod1	A	G	9: 53,935,867	I9T	probably benign	Het
Epha2	A	G	4: 141,308,979	E242G	probably benign	Het
Erbb3	T	C	10: 128,574,466	H641R	possibly damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fli1	T	C	9: 32,423,913	M408V	probably benign	Het
Fmo4	T	C	1: 162,803,618	N260S	possibly damaging	Het
Fry	A	G	5: 150,326,132	E136G	probably damaging	Het
Gm10477	T	A	X: 56,524,767	F9Y	probably damaging	Het
Gm8258	A	G	5: 104,776,454		noncoding transcript	Het
Gpr68	T	A	12: 100,878,790	D165V	probably damaging	Het
Htt	T	A	5: 34,794,112	M139K	probably benign	Het
Jup	A	G	11: 100,372,294		probably null	Het
Kifc5b	G	A	17: 26,917,290		probably null	Het
Krba1	T	A	6: 48,414,049		probably null	Het
Lamp1	G	A	8: 13,167,257	G89R	probably damaging	Het
Lexm	G	A	4: 106,613,256		probably benign	Het
Lrrc17	C	T	5: 21,560,652	S44F	possibly damaging	Het
Mdga1	T	C	17: 29,852,607	T347A	probably damaging	Het
Mical3	A	T	6: 121,042,064	W66R	probably damaging	Het
Mpl	A	G	4: 118,456,829	Y73H	probably benign	Het
Mterf1b	T	A	5: 4,197,364	I335N	possibly damaging	Het
Mylk3	A	G	8: 85,352,865	I388T	probably damaging	Het
Myo15	C	T	11: 60,507,528	R2775W	probably damaging	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Ndrg1	T	C	15: 66,931,091	T137A	possibly damaging	Het
Neil3	G	T	8: 53,599,419	N381K	probably damaging	Het
Obsl1	T	C	1: 75,498,233	Y841C	probably damaging	Het
Olfr124	A	G	17: 37,805,105		probably benign	Het
Olfr711	G	A	7: 106,972,182	S54F	possibly damaging	Het
Otogl	T	C	10: 107,899,590	D111G	probably damaging	Het
Parp10	T	C	15: 76,242,851	E103G	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pcdh18	A	T	3: 49,754,705	F720L	probably damaging	Het
Phf3	T	C	1: 30,830,623	E448G	possibly damaging	Het
Pigc	A	G	1: 161,970,947	Y166C	probably damaging	Het
Pik3c2a	A	T	7: 116,417,971	S184T	probably benign	Het
Pkd1l1	A	G	11: 8,844,670		probably benign	Het
Plxnd1	G	T	6: 115,978,084		probably null	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Prl8a2	T	C	13: 27,351,054	V103A	probably benign	Het
Psg23	G	A	7: 18,610,450	T360I	probably benign	Het
Rad51c	A	T	11: 87,388,643	I323N	probably damaging	Het
Rsbn1l	C	T	5: 20,951,698	E30K	probably benign	Het
Serpina3c	C	A	12: 104,151,886	L64F	probably damaging	Het
Shroom1	A	G	11: 53,465,675	D392G	probably damaging	Het
Slc26a5	T	A	5: 21,815,727	I540L	probably benign	Het
Slc37a4	A	G	9: 44,401,511	T321A	probably damaging	Het
Slc41a2	A	G	10: 83,256,085	L438S	probably damaging	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
Spef2	C	T	15: 9,597,401	G1390R	possibly damaging	Het
Synj2	G	T	17: 6,028,550	A740S	possibly damaging	Het
Thegl	A	T	5: 77,054,584	K284M	probably benign	Het
Tigd4	A	C	3: 84,595,087	D437A	probably benign	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem106a	CAGCTCAACACGACGGTA	CAGCTCAACACGACGGTAAGCTCAACACGACGGTA	11: 101,586,378		probably benign	Het
Tmem131l	A	T	3: 83,905,076	C1313*	probably null	Het
Tmem86b	A	T	7: 4,629,699	I47N	possibly damaging	Het
Tspan13	T	C	12: 36,020,551		probably null	Het
Vps54	A	G	11: 21,300,251	T396A	probably benign	Het
Zfp106	A	T	2: 120,513,615		probably null	Het
Zfp668	T	C	7: 127,866,482		probably null	Het
Zfp809	A	T	9: 22,238,731	R175*	probably null	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1769:Plch2	UTSW	4	155000083	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2061:Plch2	UTSW	4	155042841	intron	probably benign
R2073:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5237:Plch2	UTSW	4	155010794	missense	probably benign
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5296:Plch2	UTSW	4	154989999	intron	probably null
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	intron	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTCACATCCATAGGTTTCCCA -3'
(R):5'- CAACTGGTTGCATGGTTACAA -3'

Sequencing Primer
(F):5'- TCTTGAGGCTGACCACCAAG -3'
(R):5'- GCTGGATTCCCGTTATCT -3'

Posted On

2014-06-30