Incidental Mutation 'R1875:Mical3'
ID211138
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121042064 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 66 (W66R)
Ref Sequence ENSEMBL: ENSMUSP00000145439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077159] [ENSMUST00000203254] [ENSMUST00000204248] [ENSMUST00000207889] [ENSMUST00000207968] [ENSMUST00000207993]
Predicted Effect probably damaging
Transcript: ENSMUST00000077159
AA Change: W66R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076402
Gene: ENSMUSG00000051586
AA Change: W66R

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 1.4e-7 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 4.44e-17 SMART
low complexity region 625 635 N/A INTRINSIC
LIM 763 815 2.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203254
AA Change: W66R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145254
Gene: ENSMUSG00000051586
AA Change: W66R

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 8.6e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 640 655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204248
AA Change: W66R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145439
Gene: ENSMUSG00000051586
AA Change: W66R

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:FAD_binding_3 86 142 9.1e-6 PFAM
low complexity region 162 175 N/A INTRINSIC
CH 520 619 2.2e-19 SMART
low complexity region 625 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204994
Predicted Effect probably damaging
Transcript: ENSMUST00000207889
AA Change: W66R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect silent
Transcript: ENSMUST00000207968
Predicted Effect probably benign
Transcript: ENSMUST00000207993
Meta Mutation Damage Score 0.8293 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5299:Mical3 UTSW 6 120959512 missense possibly damaging 0.71
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
R7170:Mical3 UTSW 6 120973733 intron probably null
R7344:Mical3 UTSW 6 121036544 nonsense probably null
R7414:Mical3 UTSW 6 121034113 missense probably damaging 1.00
R7455:Mical3 UTSW 6 120958744 missense probably damaging 1.00
R7649:Mical3 UTSW 6 120934948 missense probably damaging 1.00
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTGTCCCTGCTAAGCAACC -3'
(R):5'- AACCAAGCTCACGTCCTCTTTG -3'

Sequencing Primer
(F):5'- TCTCCTACCAGTGTGAAGCTAGG -3'
(R):5'- TGACCGCTTTGTCCAGGC -3'
Posted On2014-06-30