Mutagenetix > Incidental Mutations

Incidental Mutation 'R1875:C2cd3'

211141

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

039897-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1875 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100407025 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 547 (K547E)

Ref Sequence

ENSEMBL: ENSMUSP00000095859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051777
AA Change: K547E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: K547E

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098259
AA Change: K547E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: K547E

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000119647
AA Change: K169E

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: K169E

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133464

SMART Domains

Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156559

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208753

Meta Mutation Damage Score

0.0623

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.1%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,358	D772G	probably damaging	Het
Abca14	A	T	7: 120,247,967	M685L	possibly damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Adam26a	C	A	8: 43,569,851	V201L	probably benign	Het
Adamts20	G	T	15: 94,331,396	D947E	probably benign	Het
Ankrd26	A	G	6: 118,540,449		probably null	Het
Apol11a	C	A	15: 77,513,566	T39N	possibly damaging	Het
Arhgef38	T	A	3: 133,133,740		probably null	Het
Atp11b	T	C	3: 35,839,147	L883P	probably damaging	Het
Btnl10	T	A	11: 58,923,760	I422N	probably damaging	Het
Cdh2	T	A	18: 16,624,877	L549F	probably benign	Het
Celsr3	T	C	9: 108,835,838	V1825A	probably benign	Het
Cfap221	T	C	1: 119,953,659	I358V	probably benign	Het
Csmd1	T	C	8: 15,929,101	K2828E	probably damaging	Het
Ddah2	T	C	17: 35,060,845	F137S	probably damaging	Het
Ddx21	A	G	10: 62,594,068	I299T	probably damaging	Het
Dnah7a	A	T	1: 53,456,532		probably benign	Het
Elmod1	A	G	9: 53,935,867	I9T	probably benign	Het
Epha2	A	G	4: 141,308,979	E242G	probably benign	Het
Erbb3	T	C	10: 128,574,466	H641R	possibly damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fli1	T	C	9: 32,423,913	M408V	probably benign	Het
Fmo4	T	C	1: 162,803,618	N260S	possibly damaging	Het
Fry	A	G	5: 150,326,132	E136G	probably damaging	Het
Gm10477	T	A	X: 56,524,767	F9Y	probably damaging	Het
Gm8258	A	G	5: 104,776,454		noncoding transcript	Het
Gpr68	T	A	12: 100,878,790	D165V	probably damaging	Het
Htt	T	A	5: 34,794,112	M139K	probably benign	Het
Jup	A	G	11: 100,372,294		probably null	Het
Kifc5b	G	A	17: 26,917,290		probably null	Het
Krba1	T	A	6: 48,414,049		probably null	Het
Lamp1	G	A	8: 13,167,257	G89R	probably damaging	Het
Lexm	G	A	4: 106,613,256		probably benign	Het
Lrrc17	C	T	5: 21,560,652	S44F	possibly damaging	Het
Mdga1	T	C	17: 29,852,607	T347A	probably damaging	Het
Mical3	A	T	6: 121,042,064	W66R	probably damaging	Het
Mpl	A	G	4: 118,456,829	Y73H	probably benign	Het
Mterf1b	T	A	5: 4,197,364	I335N	possibly damaging	Het
Mylk3	A	G	8: 85,352,865	I388T	probably damaging	Het
Myo15	C	T	11: 60,507,528	R2775W	probably damaging	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Ndrg1	T	C	15: 66,931,091	T137A	possibly damaging	Het
Neil3	G	T	8: 53,599,419	N381K	probably damaging	Het
Obsl1	T	C	1: 75,498,233	Y841C	probably damaging	Het
Olfr124	A	G	17: 37,805,105		probably benign	Het
Olfr711	G	A	7: 106,972,182	S54F	possibly damaging	Het
Otogl	T	C	10: 107,899,590	D111G	probably damaging	Het
Parp10	T	C	15: 76,242,851	E103G	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pcdh18	A	T	3: 49,754,705	F720L	probably damaging	Het
Phf3	T	C	1: 30,830,623	E448G	possibly damaging	Het
Pigc	A	G	1: 161,970,947	Y166C	probably damaging	Het
Pik3c2a	A	T	7: 116,417,971	S184T	probably benign	Het
Pkd1l1	A	G	11: 8,844,670		probably benign	Het
Plch2	G	A	4: 154,998,508	S485F	probably damaging	Het
Plxnd1	G	T	6: 115,978,084		probably null	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Prl8a2	T	C	13: 27,351,054	V103A	probably benign	Het
Psg23	G	A	7: 18,610,450	T360I	probably benign	Het
Rad51c	A	T	11: 87,388,643	I323N	probably damaging	Het
Rsbn1l	C	T	5: 20,951,698	E30K	probably benign	Het
Serpina3c	C	A	12: 104,151,886	L64F	probably damaging	Het
Shroom1	A	G	11: 53,465,675	D392G	probably damaging	Het
Slc26a5	T	A	5: 21,815,727	I540L	probably benign	Het
Slc37a4	A	G	9: 44,401,511	T321A	probably damaging	Het
Slc41a2	A	G	10: 83,256,085	L438S	probably damaging	Het
Spef2	C	T	15: 9,597,401	G1390R	possibly damaging	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
Synj2	G	T	17: 6,028,550	A740S	possibly damaging	Het
Thegl	A	T	5: 77,054,584	K284M	probably benign	Het
Tigd4	A	C	3: 84,595,087	D437A	probably benign	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem106a	CAGCTCAACACGACGGTA	CAGCTCAACACGACGGTAAGCTCAACACGACGGTA	11: 101,586,378		probably benign	Het
Tmem131l	A	T	3: 83,905,076	C1313*	probably null	Het
Tmem86b	A	T	7: 4,629,699	I47N	possibly damaging	Het
Tspan13	T	C	12: 36,020,551		probably null	Het
Vps54	A	G	11: 21,300,251	T396A	probably benign	Het
Zfp106	A	T	2: 120,513,615		probably null	Het
Zfp668	T	C	7: 127,866,482		probably null	Het
Zfp809	A	T	9: 22,238,731	R175*	probably null	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GCCTACCTGTCTGTGAACTTG -3'
(R):5'- AGGGCTTCCAACCCACTTTC -3'

Sequencing Primer
(F):5'- CTGTCTGTGAACTTGCAGAAACC -3'
(R):5'- CCAAATTTACCCTCATATTTGGGAAC -3'

Posted On

2014-06-30