Mutagenetix > Incidental Mutations

Incidental Mutation 'R1875:Fli1'

211154

Institutional Source

Beutler Lab

Gene Symbol

Fli1

Ensembl Gene

ENSMUSG00000016087

Gene Name

Friend leukemia integration 1

Synonyms

SIC-1, EWSR2, Sic1, Fli-1

MMRRC Submission

039897-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.606) question?

Stock #

R1875 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32422204-32542861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32423913 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 408 (M408V)

Ref Sequence

ENSEMBL: ENSMUSP00000016231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016231] [ENSMUST00000183767]

Predicted Effect

probably benign
Transcript: ENSMUST00000016231
AA Change: M408V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000016231
Gene: ENSMUSG00000016087
AA Change: M408V

Domain	Start	End	E-Value	Type
SAM_PNT	114	198	2.52e-38	SMART
ETS	280	365	1.22e-57	SMART
low complexity region	402	414	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183767

SMART Domains

Protein: ENSMUSP00000138984
Gene: ENSMUSG00000016087

Domain	Start	End	E-Value	Type
SAM_PNT	81	165	2.52e-38	SMART

Meta Mutation Damage Score

0.0853

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.1%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for most knock-out allele exhibit abnormal hematopoietic and immune systems. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,358	D772G	probably damaging	Het
Abca14	A	T	7: 120,247,967	M685L	possibly damaging	Het
Abi3bp	A	G	16: 56,574,499	Y190C	probably damaging	Het
Adam26a	C	A	8: 43,569,851	V201L	probably benign	Het
Adamts20	G	T	15: 94,331,396	D947E	probably benign	Het
Ankrd26	A	G	6: 118,540,449		probably null	Het
Apol11a	C	A	15: 77,513,566	T39N	possibly damaging	Het
Arhgef38	T	A	3: 133,133,740		probably null	Het
Atp11b	T	C	3: 35,839,147	L883P	probably damaging	Het
Btnl10	T	A	11: 58,923,760	I422N	probably damaging	Het
C2cd3	A	G	7: 100,407,025	K547E	possibly damaging	Het
Cdh2	T	A	18: 16,624,877	L549F	probably benign	Het
Celsr3	T	C	9: 108,835,838	V1825A	probably benign	Het
Cfap221	T	C	1: 119,953,659	I358V	probably benign	Het
Csmd1	T	C	8: 15,929,101	K2828E	probably damaging	Het
Ddah2	T	C	17: 35,060,845	F137S	probably damaging	Het
Ddx21	A	G	10: 62,594,068	I299T	probably damaging	Het
Dnah7a	A	T	1: 53,456,532		probably benign	Het
Elmod1	A	G	9: 53,935,867	I9T	probably benign	Het
Epha2	A	G	4: 141,308,979	E242G	probably benign	Het
Erbb3	T	C	10: 128,574,466	H641R	possibly damaging	Het
Fbxl18	G	A	5: 142,886,223	A419V	probably damaging	Het
Fmo4	T	C	1: 162,803,618	N260S	possibly damaging	Het
Fry	A	G	5: 150,326,132	E136G	probably damaging	Het
Gm10477	T	A	X: 56,524,767	F9Y	probably damaging	Het
Gm8258	A	G	5: 104,776,454		noncoding transcript	Het
Gpr68	T	A	12: 100,878,790	D165V	probably damaging	Het
Htt	T	A	5: 34,794,112	M139K	probably benign	Het
Jup	A	G	11: 100,372,294		probably null	Het
Kifc5b	G	A	17: 26,917,290		probably null	Het
Krba1	T	A	6: 48,414,049		probably null	Het
Lamp1	G	A	8: 13,167,257	G89R	probably damaging	Het
Lexm	G	A	4: 106,613,256		probably benign	Het
Lrrc17	C	T	5: 21,560,652	S44F	possibly damaging	Het
Mdga1	T	C	17: 29,852,607	T347A	probably damaging	Het
Mical3	A	T	6: 121,042,064	W66R	probably damaging	Het
Mpl	A	G	4: 118,456,829	Y73H	probably benign	Het
Mterf1b	T	A	5: 4,197,364	I335N	possibly damaging	Het
Mylk3	A	G	8: 85,352,865	I388T	probably damaging	Het
Myo15	C	T	11: 60,507,528	R2775W	probably damaging	Het
Myoz2	A	T	3: 123,026,116	S65T	probably damaging	Het
Ndrg1	T	C	15: 66,931,091	T137A	possibly damaging	Het
Neil3	G	T	8: 53,599,419	N381K	probably damaging	Het
Obsl1	T	C	1: 75,498,233	Y841C	probably damaging	Het
Olfr124	A	G	17: 37,805,105		probably benign	Het
Olfr711	G	A	7: 106,972,182	S54F	possibly damaging	Het
Otogl	T	C	10: 107,899,590	D111G	probably damaging	Het
Parp10	T	C	15: 76,242,851	E103G	probably damaging	Het
Pars2	T	C	4: 106,653,716	F232L	possibly damaging	Het
Pcdh18	A	T	3: 49,754,705	F720L	probably damaging	Het
Phf3	T	C	1: 30,830,623	E448G	possibly damaging	Het
Pigc	A	G	1: 161,970,947	Y166C	probably damaging	Het
Pik3c2a	A	T	7: 116,417,971	S184T	probably benign	Het
Pkd1l1	A	G	11: 8,844,670		probably benign	Het
Plch2	G	A	4: 154,998,508	S485F	probably damaging	Het
Plxnd1	G	T	6: 115,978,084		probably null	Het
Pnliprp2	G	T	19: 58,763,389	V189L	probably benign	Het
Prl8a2	T	C	13: 27,351,054	V103A	probably benign	Het
Psg23	G	A	7: 18,610,450	T360I	probably benign	Het
Rad51c	A	T	11: 87,388,643	I323N	probably damaging	Het
Rsbn1l	C	T	5: 20,951,698	E30K	probably benign	Het
Serpina3c	C	A	12: 104,151,886	L64F	probably damaging	Het
Shroom1	A	G	11: 53,465,675	D392G	probably damaging	Het
Slc26a5	T	A	5: 21,815,727	I540L	probably benign	Het
Slc37a4	A	G	9: 44,401,511	T321A	probably damaging	Het
Slc41a2	A	G	10: 83,256,085	L438S	probably damaging	Het
Spef2	C	T	15: 9,584,108	E1624K	probably damaging	Het
Spef2	C	T	15: 9,597,401	G1390R	possibly damaging	Het
Synj2	G	T	17: 6,028,550	A740S	possibly damaging	Het
Thegl	A	T	5: 77,054,584	K284M	probably benign	Het
Tigd4	A	C	3: 84,595,087	D437A	probably benign	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem106a	CAGCTCAACACGACGGTA	CAGCTCAACACGACGGTAAGCTCAACACGACGGTA	11: 101,586,378		probably benign	Het
Tmem131l	A	T	3: 83,905,076	C1313*	probably null	Het
Tmem86b	A	T	7: 4,629,699	I47N	possibly damaging	Het
Tspan13	T	C	12: 36,020,551		probably null	Het
Vps54	A	G	11: 21,300,251	T396A	probably benign	Het
Zfp106	A	T	2: 120,513,615		probably null	Het
Zfp668	T	C	7: 127,866,482		probably null	Het
Zfp809	A	T	9: 22,238,731	R175*	probably null	Het

Other mutations in Fli1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Fli1	APN	9	32423940	missense	probably benign	0.31
IGL01329:Fli1	APN	9	32424101	missense	probably damaging	1.00
IGL01925:Fli1	APN	9	32465831	missense	probably damaging	1.00
IGL01951:Fli1	APN	9	32461364	missense	probably damaging	0.99
IGL01963:Fli1	APN	9	32424207	nonsense	probably null
IGL02889:Fli1	APN	9	32465696	missense	probably damaging	1.00
R0026:Fli1	UTSW	9	32476584	missense	probably damaging	1.00
R0243:Fli1	UTSW	9	32423981	missense	probably benign	0.00
R0279:Fli1	UTSW	9	32461427	missense	probably damaging	1.00
R0418:Fli1	UTSW	9	32452129	splice site	probably benign
R0967:Fli1	UTSW	9	32461449	missense	probably benign
R1228:Fli1	UTSW	9	32423843	missense	probably damaging	1.00
R1557:Fli1	UTSW	9	32461244	splice site	probably benign
R3401:Fli1	UTSW	9	32461274	missense	probably damaging	1.00
R3898:Fli1	UTSW	9	32476722	missense	possibly damaging	0.88
R4051:Fli1	UTSW	9	32452162	missense	probably benign	0.03
R6440:Fli1	UTSW	9	32423901	missense	probably benign	0.07
R6901:Fli1	UTSW	9	32429925	missense	probably benign	0.14
R7061:Fli1	UTSW	9	32424222	missense	probably damaging	0.98
R7231:Fli1	UTSW	9	32424188	missense	probably damaging	1.00
R7676:Fli1	UTSW	9	32428030	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CTACTGTGCCTTTTAGAGTCCAG -3'
(R):5'- ATTATGACCAAAGTGCATGGC -3'

Sequencing Primer
(F):5'- GCCTTTTAGAGTCCAGAGTATCCAG -3'
(R):5'- TGCATGGCAAAAGGTATGCCTAC -3'

Posted On

2014-06-30