Incidental Mutation 'R1875:Slc41a2'
ID211159
Institutional Source Beutler Lab
Gene Symbol Slc41a2
Ensembl Gene ENSMUSG00000034591
Gene Namesolute carrier family 41, member 2
SynonymsA230035L05Rik
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83230848-83337882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83256085 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 438 (L438S)
Ref Sequence ENSEMBL: ENSMUSP00000036690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039956]
Predicted Effect probably damaging
Transcript: ENSMUST00000039956
AA Change: L438S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036690
Gene: ENSMUSG00000034591
AA Change: L438S

DomainStartEndE-ValueType
transmembrane domain 159 181 N/A INTRINSIC
Pfam:MgtE 200 334 8.7e-24 PFAM
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Pfam:MgtE 414 557 2.9e-32 PFAM
Meta Mutation Damage Score 0.1147 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Slc41a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Slc41a2 APN 10 83313530 unclassified probably benign
IGL02263:Slc41a2 APN 10 83313500 missense possibly damaging 0.82
IGL02338:Slc41a2 APN 10 83316591 missense possibly damaging 0.68
IGL02680:Slc41a2 APN 10 83283864 missense probably benign 0.20
IGL02703:Slc41a2 APN 10 83254847 missense probably damaging 1.00
IGL03039:Slc41a2 APN 10 83283858 missense probably benign 0.37
PIT4508001:Slc41a2 UTSW 10 83254880 missense probably damaging 0.99
R0326:Slc41a2 UTSW 10 83283746 missense probably damaging 1.00
R0470:Slc41a2 UTSW 10 83316222 missense possibly damaging 0.94
R0610:Slc41a2 UTSW 10 83283728 missense possibly damaging 0.75
R1708:Slc41a2 UTSW 10 83233732 missense probably damaging 1.00
R1765:Slc41a2 UTSW 10 83301266 missense probably damaging 1.00
R1870:Slc41a2 UTSW 10 83301165 nonsense probably null
R2008:Slc41a2 UTSW 10 83304303 critical splice donor site probably null
R2172:Slc41a2 UTSW 10 83283774 missense probably benign 0.00
R4193:Slc41a2 UTSW 10 83301221 missense probably damaging 0.97
R4789:Slc41a2 UTSW 10 83316456 missense probably damaging 1.00
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4861:Slc41a2 UTSW 10 83316458 missense probably damaging 0.99
R4913:Slc41a2 UTSW 10 83313420 missense probably damaging 1.00
R5012:Slc41a2 UTSW 10 83301263 missense probably benign 0.02
R5140:Slc41a2 UTSW 10 83297291 missense probably damaging 0.98
R5189:Slc41a2 UTSW 10 83313411 unclassified probably null
R5410:Slc41a2 UTSW 10 83281368 critical splice donor site probably null
R5748:Slc41a2 UTSW 10 83297159 missense probably benign 0.00
R5808:Slc41a2 UTSW 10 83313498 missense probably benign 0.29
R6124:Slc41a2 UTSW 10 83297252 missense probably damaging 1.00
R6292:Slc41a2 UTSW 10 83254926 missense probably damaging 0.99
R6511:Slc41a2 UTSW 10 83283788 missense probably damaging 0.99
R6793:Slc41a2 UTSW 10 83301158 splice site probably null
R6970:Slc41a2 UTSW 10 83316096 missense possibly damaging 0.53
R7584:Slc41a2 UTSW 10 83316789 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GACACAGAGGGCCTTTGTTC -3'
(R):5'- CTGCCGTTTCAGAGAAAGATG -3'

Sequencing Primer
(F):5'- TTAGCTCAGCCCAGCATG -3'
(R):5'- CCGTTTCAGAGAAAGATGTGTTTCC -3'
Posted On2014-06-30