Incidental Mutation 'R1875:Otogl'
ID211160
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107899590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 111 (D111G)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably damaging
Transcript: ENSMUST00000165341
AA Change: D111G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: D111G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Meta Mutation Damage Score 0.3319 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTAGAGCCCTAGGTGTTC -3'
(R):5'- CCGGATCTGTCTCTTGGAAAC -3'

Sequencing Primer
(F):5'- AGAGCCCTAGGTGTTCTATAATTATC -3'
(R):5'- CTGAATATTTTGAGATCGATGGG -3'
Posted On2014-06-30