Incidental Mutation 'R1875:Ndrg1'
ID211179
Institutional Source Beutler Lab
Gene Symbol Ndrg1
Ensembl Gene ENSMUSG00000005125
Gene NameN-myc downstream regulated gene 1
SynonymsTDD5, CMT4D, CAP43, DRG1, Tdd5, Ndr1, PROXY1, Ndrl
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66929318-66969640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66931091 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 137 (T137A)
Ref Sequence ENSEMBL: ENSMUSP00000127099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005256] [ENSMUST00000166420]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005256
AA Change: T321A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005256
Gene: ENSMUSG00000005125
AA Change: T321A

DomainStartEndE-ValueType
Pfam:Ndr 34 316 4.4e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165966
Predicted Effect possibly damaging
Transcript: ENSMUST00000166420
AA Change: T137A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127099
Gene: ENSMUSG00000005125
AA Change: T137A

DomainStartEndE-ValueType
Pfam:Ndr 17 132 1.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171569
Meta Mutation Damage Score 0.4373 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous null mice exhibit a progressive demyelinating disorder of the peripheral nerves with hindlimb weakness. Mice homozygous for a different knock-out allele exhibit decreased cellular susceptibility to gamma-irradiation and increased susceptibility to spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Ndrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Ndrg1 APN 15 66943110 missense probably damaging 1.00
IGL01419:Ndrg1 APN 15 66931051 missense probably benign 0.01
IGL02618:Ndrg1 APN 15 66940237 missense probably benign 0.03
IGL02869:Ndrg1 APN 15 66946497 missense probably benign 0.01
IGL03206:Ndrg1 APN 15 66943087 nonsense probably null
PIT4377001:Ndrg1 UTSW 15 66948439 missense probably benign
R0328:Ndrg1 UTSW 15 66943159 splice site probably benign
R1102:Ndrg1 UTSW 15 66944836 missense probably damaging 1.00
R1105:Ndrg1 UTSW 15 66940231 missense probably damaging 0.99
R1748:Ndrg1 UTSW 15 66931081 missense possibly damaging 0.55
R5214:Ndrg1 UTSW 15 66959390 missense probably damaging 0.99
R5809:Ndrg1 UTSW 15 66930850 unclassified probably benign
R6433:Ndrg1 UTSW 15 66933872 missense probably damaging 1.00
R7104:Ndrg1 UTSW 15 66946528 missense probably damaging 1.00
R7412:Ndrg1 UTSW 15 66960533 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCAGGACACCTCCATGGAC -3'
(R):5'- TGACACAGAAGGTAGATGGCTC -3'

Sequencing Primer
(F):5'- ACACCTCCATGGACTTGGG -3'
(R):5'- ATGGCTCACAGGATGAAGAC -3'
Posted On2014-06-30