Incidental Mutation 'R1875:Parp10'
ID211180
Institutional Source Beutler Lab
Gene Symbol Parp10
Ensembl Gene ENSMUSG00000063268
Gene Namepoly (ADP-ribose) polymerase family, member 10
Synonyms
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1875 (G1)
Quality Score223
Status Validated
Chromosome15
Chromosomal Location76231174-76243441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76242851 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 103 (E103G)
Ref Sequence ENSEMBL: ENSMUSP00000129765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023225] [ENSMUST00000075689] [ENSMUST00000165738] [ENSMUST00000229380] [ENSMUST00000229772] [ENSMUST00000230347]
Predicted Effect probably benign
Transcript: ENSMUST00000023225
SMART Domains Protein: ENSMUSP00000023225
Gene: ENSMUSG00000022564

DomainStartEndE-ValueType
low complexity region 27 101 N/A INTRINSIC
Pfam:Bax1-I 133 340 6.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075689
AA Change: E103G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075110
Gene: ENSMUSG00000063268
AA Change: E103G

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165738
AA Change: E103G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129765
Gene: ENSMUSG00000063268
AA Change: E103G

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166151
Predicted Effect probably benign
Transcript: ENSMUST00000229380
Predicted Effect probably benign
Transcript: ENSMUST00000229772
Predicted Effect probably benign
Transcript: ENSMUST00000230347
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) polymerases (PARPs), such as PARP10, regulate gene transcription by altering chromatin organization by adding ADP-ribose to histones. PARPs can also function as transcriptional cofactors (Yu et al., 2005 [PubMed 15674325]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Parp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Parp10 APN 15 76241677 missense probably benign 0.09
IGL01419:Parp10 APN 15 76241388 missense probably damaging 1.00
PIT4687001:Parp10 UTSW 15 76240922 missense probably benign 0.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0126:Parp10 UTSW 15 76243066 missense probably damaging 0.98
R0207:Parp10 UTSW 15 76242633 missense probably benign 0.00
R1300:Parp10 UTSW 15 76241990 missense possibly damaging 0.93
R1412:Parp10 UTSW 15 76243084 missense probably damaging 0.99
R1510:Parp10 UTSW 15 76241417 missense probably damaging 1.00
R1670:Parp10 UTSW 15 76242070 missense probably benign 0.01
R2219:Parp10 UTSW 15 76233583 missense probably damaging 1.00
R2351:Parp10 UTSW 15 76242856 missense probably benign
R4027:Parp10 UTSW 15 76241154 critical splice donor site probably null
R4659:Parp10 UTSW 15 76242985 missense probably damaging 1.00
R4763:Parp10 UTSW 15 76233427 missense probably damaging 0.99
R4828:Parp10 UTSW 15 76243081 missense probably benign 0.00
R5066:Parp10 UTSW 15 76240946 splice site probably benign
R5090:Parp10 UTSW 15 76241725 missense probably damaging 0.97
R5495:Parp10 UTSW 15 76243166 missense probably benign
R6271:Parp10 UTSW 15 76242002 missense probably benign
R6335:Parp10 UTSW 15 76242188 missense probably benign 0.00
R6503:Parp10 UTSW 15 76242484 missense probably damaging 1.00
R6606:Parp10 UTSW 15 76240108 missense possibly damaging 0.66
R6868:Parp10 UTSW 15 76243106 missense probably damaging 1.00
R7197:Parp10 UTSW 15 76242416 missense probably damaging 1.00
X0027:Parp10 UTSW 15 76241504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTAGAAGCTATGCCGCCC -3'
(R):5'- TTCAAGATCCTGCAGGTGAGGAG -3'

Sequencing Primer
(F):5'- GTGGATAACTGGACCAGG -3'
(R):5'- TGAATCAAGAGGTTGCCTGG -3'
Posted On2014-06-30